BBa_K511500 1 BBa_K511500 pDisplay-Vasopressin-MYC Ligand MammoBlock 2011-09-26T11:00:00Z 2015-05-08T01:12:31Z This protein includes a human codon-optimized version of the arginine vasopressin sequence, the MYC epitope from the human c-MYC DNA-binding transcription factor, and the transmembrane domain from the murine platelet-derived growth factor receptor. This part encodes a novel fusion protein that serves to display the arginine vasopressin hormone in the extracellular space of a mammalian cell. This protein consists of the transmembrane domain of the platelet-derived growth factor receptor, the sequence for arginine vasopressin, and the sequence for the MYC epitope. This synthetic ligand was designed for juxtacrine signaling to the arginine vasopressin receptor (AVPR) class, and was specifically designed to function with the AVPR2-TEVs-Gal4-VP16 construct. false false _674_ 0 6719 9 It's complicated false Not applicable. false Grant Robinson annotation2144663 1 MYC Epitope Tag range2144663 1 91 120 annotation2144662 1 PDGFR Transmembrane Domain range2144662 1 121 270 annotation2144664 1 Arginine Vasopressin range2144664 1 64 90 annotation2144665 1 Murine Ig-Kappa Signal Peptide range2144665 1 1 63 BBa_K511500_sequence 1 atggagacagacacactcctgctatgggtactgctgctctgggttccaggttccactggtgactcctacttccagaactctcccagcggcgaacaaaaactcatctcagaagaggatctgaatgctgtgggccaggacacgcaggaggtcatcgtggtgccacactccttgccctttaaggtggtggtgatctcagccatcctggccctggtggtgctcaccatcatctcccttatcatcctcatcatgctttggcagaagaagccacgttag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z