BBa_J85600 1 BBa_J85600 attB1 recombination site 2011-09-05T11:00:00Z 2015-05-08T01:08:30Z lambda phage attB1 recombination site Used for creating mammoblock (RFC65) composite promoter-gene pairs using recombination-based cloning. false false _406_ 0 106 406 Not in stock false None false Ron Weiss annotation2125966 1 attB1 range2125966 1 2 22 BBa_K511001 1 BBa_K511001 minCMV-1xCI434 Promoter MammoBlock 2011-09-24T11:00:00Z 2015-05-08T01:12:31Z This promoter is a synthetic construct composed of the minimal sequence required for transcription from the immediate-early cytomegalovirus (CMV) promoter preceded by a binding site for the CI434 protein adapted from bacteriophage 434. This part encodes a promoter that is moderately inducible by the CI434-VP16 transactivator and constitutively off otherwise. As shown in Figures 1 and 2 below, induction with the CI434-VP16 transactivator results in marked increase in fluorescence from a construct containing a red fluorescent protein (mKate) driven by the minCMV-1xCI434 promoter. false false _674_ 0 6719 9 It's complicated false This particular promoter has a propensity to mutate in cells that are not exceptionally recombination-deficient, and caution should be taken in producing both entry and expression vectors using this part. false Grant Robinson annotation2139544 1 minCMV Promoter range2139544 1 56 113 annotation2139543 1 CI434 Box range2139543 1 1 46 BBa_K511812 1 BBa_K511812 CI434-VP16-Inducible Red Fluorescence Generator (minCMV-1xCI434-mKate) MammoBlock Device 2011-09-27T11:00:00Z 2015-05-08T01:12:31Z Consult constituent components. This MammoBlock composite device produces the monomeric red fluorescent protein mKate driven by the minCMV-1xCI434 promoter. In the absence of CI434-VP16, transcription of mKate is very low, but in the presence of CI434-VP16, transcription is moderately high. false false _674_ 0 6719 9 Not in stock false In order to adhere to the recombination-based MammoBlock standard, and because shipping Biosafety Level 2 mammalian expression vectors to the Registry of Standard Biological Parts is not currently possible, we are providing the sequence resulting from Gateway recombination of the constituent MammoBlock parts here without redistributing the physical DNA plasmids to the Registry. In future years, we hope to make use of improvements in the Registry's accommodations to provide our complete expression vectors. false Grant Robinson component2146106 1 BBa_K511001 component2146108 1 BBa_J85600 component2146110 1 BBa_K511102 annotation2146106 1 BBa_K511001 range2146106 1 1 113 annotation2146110 1 BBa_K511102 range2146110 1 136 849 annotation2146108 1 BBa_J85600 range2146108 1 114 135 BBa_K511102 1 BBa_K511102 mKate MammoBlock 2011-09-24T11:00:00Z 2015-05-08T01:12:31Z This protein was codon-optimized for mammalian expression and is closely homologous to the natural green fluorescent protein derived from Aequorea victoria. A mammalian-codon optimized red fluorescent protein. This protein is a significantly engineered reporter protein that, unlikely many fluorescent proteins, is monomeric and therefore ideal for fusion constructs. Figures 1 and 2 show typical levels of mKate-mediated fluorescence following transfection of HEK-293 cells with mKate driven by the Hef1a low-level constitutive promoter. false false _674_ 0 6719 9 It's complicated false Not applicable. false Grant Robinson annotation2139566 1 mKate Fluorescent Protein range2139566 1 1 714 BBa_J85600_sequence 1 ccaagtttgtacaaaaaagcag BBa_K511812_sequence 1 ttgacaaacaagatacattgtatgaaaatacaagaaagtttgttgacgtcgaggtaggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcgccaagtttgtacaaaaaagcagatggtgtctaagggcgaagagctgattaaggagaacatgcacatgaagctgtacatggagggcaccgtgaacaaccaccacttcaagtgcacatccgagggcgaaggcaagccctacgagggcacccagaccatgagaatcaaggtggtcgagggcggccctctccccttcgccttcgacatcctggctaccagcttcatgtacggcagcaaaaccttcatcaaccacacccagggcatccccgacttctttaagcagtccttccctgagggcttcacatgggagagagtcaccacatacgaagacgggggcgtgctgaccgctacccaggacaccagcctccaggacggctgcctcatctacaacgtcaagatcagaggggtgaacttcccatccaacggccctgtgatgcagaagaaaacactcggctgggaggcctccaccgagatgctgtaccccgctgacggcggcctggaaggcagaagcgacatggccctgaagctcgtgggcgggggccacctgatctgcaacttgaagaccacatacagatccaagaaacccgctaagaacctcaagatgcccggcgtctactatgtggacagaagactggaaagaatcaaggaggccgacaaagagacctacgtcgagcagcacgaggtggctgtggccagatactgcgacctccctagcaaactggggcacaaacttaattga BBa_K511102_sequence 1 atggtgtctaagggcgaagagctgattaaggagaacatgcacatgaagctgtacatggagggcaccgtgaacaaccaccacttcaagtgcacatccgagggcgaaggcaagccctacgagggcacccagaccatgagaatcaaggtggtcgagggcggccctctccccttcgccttcgacatcctggctaccagcttcatgtacggcagcaaaaccttcatcaaccacacccagggcatccccgacttctttaagcagtccttccctgagggcttcacatgggagagagtcaccacatacgaagacgggggcgtgctgaccgctacccaggacaccagcctccaggacggctgcctcatctacaacgtcaagatcagaggggtgaacttcccatccaacggccctgtgatgcagaagaaaacactcggctgggaggcctccaccgagatgctgtaccccgctgacggcggcctggaaggcagaagcgacatggccctgaagctcgtgggcgggggccacctgatctgcaacttgaagaccacatacagatccaagaaacccgctaagaacctcaagatgcccggcgtctactatgtggacagaagactggaaagaatcaaggaggccgacaaagagacctacgtcgagcagcacgaggtggctgtggccagatactgcgacctccctagcaaactggggcacaaacttaattga BBa_K511001_sequence 1 ttgacaaacaagatacattgtatgaaaatacaagaaagtttgttgacgtcgaggtaggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z