BBa_K511101 1 BBa_K511101 EYFP-FF4x4 MammoBlock 2011-09-24T11:00:00Z 2015-05-08T01:12:31Z This protein is an engineered version of the original green fluorescent protein from Aequorea victoria that has ben modified to fluoresce yellow. This part is an engineered variant of the original green fluorescent protein from Aequorea victoria that fluoresces yellow. Additionally, this protein has four binding sites for the FF4 micro RNA (miRNA). In the presence of FF4 miRNA, translation of this protein is markedly attenuated. Figures 1 and 2 show typical levels of EYFP-FF4x4-mediated fluorescence following transfection of HEK-293 cells with EYFP-FF4x4 driven by the Hef1a-LacOid low-level constitutive promoter. false false _674_ 0 6719 9 It's complicated false The presence of FF4 binding sites on this protein will preclude its use in certain cells that naturally produce the FF4 miRNA, and it is recommended that parties interested in using this part consult references explaining which miRNAs are produced in their desired cell types. false Grant Robinson annotation2139558 1 Enhanced Yellow Fluorescent Protein range2139558 1 1 720 annotation2139559 1 Four FF4 Binding Sites range2139559 1 732 819 BBa_K511822 1 BBa_K511822 Inducible Yellow Fluorescent Protein Generator (UAS-Gal4-EYFP-FF4x4) MammoBlock Device 2011-09-27T11:00:00Z 2015-05-08T01:12:31Z Consult constituent components. This MammoBlock composite device produces the yellow fluorescent protein EYFP-FF4x4 when induced with Gal4 transactivator variants and otherwise produces EYFP-FF4x4 at a low, basal (OFF) level. Note that the presence of the FF4 repeats on EYFP-FF4x4 means that this device can be repressed by the FF4 micro RNA. false false _674_ 0 6719 9 Not in stock false In order to adhere to the recombination-based MammoBlock standard, and because shipping Biosafety Level 2 mammalian expression vectors to the Registry of Standard Biological Parts is not currently possible, we are providing the sequence resulting from Gateway recombination of the constituent MammoBlock parts here without redistributing the physical DNA plasmids to the Registry. In future years, we hope to make use of improvements in the Registry's accommodations to provide our complete expression vectors. false Grant Robinson component2146269 1 BBa_J85600 component2146267 1 BBa_K511003 component2146272 1 BBa_K511101 annotation2146269 1 BBa_J85600 range2146269 1 221 242 annotation2146272 1 BBa_K511101 range2146272 1 243 1061 annotation2146267 1 BBa_K511003 range2146267 1 1 220 BBa_K511003 1 BBa_K511003 UAS-Gal4 Promoter MammoBlock 2011-09-24T11:00:00Z 2015-05-08T01:12:31Z This part was synthesized to include the upstream activator sequence (UAS) from the Saccharomyces cerevisiae genome that binds to the Gal4 transactivator upstream of the major-late adenovirus promoter. This part encodes a promoter that is inducible by variants of the Gal4 transactivator and off otherwise. As shown in Figures 1 and 2, fluorescence from a red fluorescent protein (mKate) driven by the UAS-Gal4 promoter is very strong in the presence of constitutively produced Gal4 derivative with an attached viral VP16 transactivation domain (Gal4-VP16), and is essentially off in the absences of the Gal4-VP16 transactivator. false false _674_ 0 6719 9 It's complicated true Not applicable. false Grant Robinson annotation2139552 1 Gal4-Binding Region range2139552 1 46 148 annotation2139553 1 Major-Late Adenovirus Promoter range2139553 1 160 200 BBa_J85600 1 BBa_J85600 attB1 recombination site 2011-09-05T11:00:00Z 2015-05-08T01:08:30Z lambda phage attB1 recombination site Used for creating mammoblock (RFC65) composite promoter-gene pairs using recombination-based cloning. false false _406_ 0 106 406 Not in stock false None false Ron Weiss annotation2125966 1 attB1 range2125966 1 2 22 BBa_J85600_sequence 1 ccaagtttgtacaaaaaagcag BBa_K511822_sequence 1 gctccgaattgggacagcagagatccagtttggttaattaatagacggagtactgtcctccgagcggagtactgtcctccgactcgagcggagtactgtcctccgatcggagtactgtcctccgcgaattccggagtactgtcctccgaagacgctagcggggggctataaaagggggtgggggcgttcgtcctcactctcaattcggcccaattcgaccccaagtttgtacaaaaaagcagatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcagtgcttcgcccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccaagctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaaagcggcgcgccccgcttgaagtctttaattaaaccgcttgaagtctttaattaaaccgcttgaagtctttaattaaaccgcttgaagtctttaattaaa BBa_K511101_sequence 1 atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcagtgcttcgcccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccaagctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaaagcggcgcgccccgcttgaagtctttaattaaaccgcttgaagtctttaattaaaccgcttgaagtctttaattaaaccgcttgaagtctttaattaaa BBa_K511003_sequence 1 gctccgaattgggacagcagagatccagtttggttaattaatagacggagtactgtcctccgagcggagtactgtcctccgactcgagcggagtactgtcctccgatcggagtactgtcctccgcgaattccggagtactgtcctccgaagacgctagcggggggctataaaagggggtgggggcgttcgtcctcactctcaattcggcccaattcgacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z