BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_K515004 1 BBa_K515004 T4 Anti-Holin 2011-09-06T11:00:00Z 2015-05-08T01:12:32Z genomics An antitoxin sequence for holin false false _680_ 0 10179 9 Not in stock false - false Atipat Patharagulpong annotation2129767 1 rbs range2129767 1 16 35 annotation2129766 1 insulator range2129766 1 1 15 annotation2129768 1 antiholin range2129768 1 36 332 BBa_K515104 1 BBa_K515104 J23100 promoter - Antiholin 2011-09-06T11:00:00Z 2015-05-08T01:12:32Z - A composite part between J23100 and antiholin false false _680_ 0 10179 9 It's complicated false - false Atipat Patharagulpong component2129769 1 BBa_J23100 component2129774 1 BBa_B0010 component2129776 1 BBa_B0012 component2129773 1 BBa_K515004 annotation2129774 1 BBa_B0010 range2129774 1 368 447 annotation2129773 1 BBa_K515004 range2129773 1 36 367 annotation2129776 1 BBa_B0012 range2129776 1 448 488 annotation2129769 1 BBa_J23100 range2129769 1 1 35 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_K515004_sequence 1 cagcctgcggtccgggcgataataaggaggtactaatggccttaaaagcaacagcactttttgccatgctaggattgtcatttgttttatctccatcgattgaagcgaatgtcgatcctcattttgataaatttatggaatctggtattaggcacgtttatatgctttttgaaaataaaagcgtagaatcgtctgaacaattctatagttttatgagaacgacctataaaaatgacccgtgctcttctgattttgaatgtatagagcgaggcgcggagatggcacaatcatacgctagaattatgaacattaaattggagactgaataataa BBa_K515104_sequence 1 ttgacggctagctcagtcctaggtacagtgctagccagcctgcggtccgggcgataataaggaggtactaatggccttaaaagcaacagcactttttgccatgctaggattgtcatttgttttatctccatcgattgaagcgaatgtcgatcctcattttgataaatttatggaatctggtattaggcacgtttatatgctttttgaaaataaaagcgtagaatcgtctgaacaattctatagttttatgagaacgacctataaaaatgacccgtgctcttctgattttgaatgtatagagcgaggcgcggagatggcacaatcatacgctagaattatgaacattaaattggagactgaataataaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z