BBa_K519010 1 BBa_K519010 SmtA 2011-09-29T11:00:00Z 2016-01-13T10:24:13Z Synechococcus sp. PCC7942 Released HQ 2013 SmtA is a metallothionein that can bind to heavy metal ions such as Cd(II). This SmtA is cloned from Synechococcus sp. PCC7942 and it has been reported that the cyanobacterial strains that express SmtA can resist medium containing cadmim. false true _684_ 4206 9603 9 In stock false This part was cloned from Synechococcus sp. PCC7942, using primers to add EcoRI, XbaI and SpeI at the ends. false Kotone Miyake BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K519011 1 BBa_K519011 SmtA-Double Term. 2011-09-29T11:00:00Z 2016-01-13T12:59:12Z Synechococcus sp. PCC7942 SmtA is a metallothionein that can bind to metal ions such as Cd(II). false true _684_ 4206 9603 9 It's complicated false This part is put together with Double terminator. false Kotone Miyake component2147679 1 BBa_K519010 component2147686 1 BBa_B0015 annotation2147679 1 BBa_K519010 range2147679 1 1 171 annotation2147686 1 BBa_B0015 range2147686 1 180 308 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K519011_sequence 1 atgacctcaacaacgttggtcaaatgcgcttgtgagccctgtctctgcaacgtcgatcccagcaaagcgatcgatcgcaacggtctgtactactgcagcgaagcctgtgccgatggccacaccggtggtagcaaaggctgcggccacaccggctgtaactgccacggctaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K519010_sequence 1 atgacctcaacaacgttggtcaaatgcgcttgtgagccctgtctctgcaacgtcgatcccagcaaagcgatcgatcgcaacggtctgtactactgcagcgaagcctgtgccgatggccacaccggtggtagcaaaggctgcggccacaccggctgtaactgccacggctaa BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z