BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_J23102 1 BBa_J23102 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z isolated from library of promoters Released HQ 2013 replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K519013 1 BBa_K519013 Promoter and RBS with PduP1~18 and Term. 2011-09-29T11:00:00Z 2015-05-08T01:12:33Z Citrobacter Freundii Terminator was added at the end of PduP1~18, to our registered part BBa_K519012 false false _684_ 0 9603 9 It's complicated false None false Kotone Miyake component2220826 1 BBa_B0034 component2220835 1 BBa_B0015 component2220825 1 BBa_J23102 component2220828 1 BBa_K519012 annotation2220825 1 BBa_J23102 range2220825 1 1 35 annotation2220828 1 BBa_K519012 range2220828 1 1 115 annotation2220826 1 BBa_B0034 range2220826 1 44 55 annotation2220835 1 BBa_B0015 range2220835 1 124 252 BBa_K519012 1 BBa_K519012 Promoter and RBS with PduP1~18 tag 2011-09-29T11:00:00Z 2015-05-08T01:12:33Z Citrobacter Freundii This part constitutes of a PduP protein with the N-terminal ends known to be needed to be taken into Pdu BMC. false false _684_ 0 9603 9 In stock false N-terminal of PduP is expressed under a promoter and RBS false Kotone Miyake annotation2147773 1 BBa_J23102 range2147773 1 1 35 annotation2147774 1 BBa_B0034 range2147774 1 44 55 annotation2147775 1 protein range2147775 1 62 115 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K519013_sequence 1 ttgacagctagctcagtcctaggtactgtgctagctactagagaaagaggagaaatactagatgaacacttcagaacttgaaacccttattcgtaacattttgagtgagcaactttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_J23102_sequence 1 ttgacagctagctcagtcctaggtactgtgctagc BBa_K519012_sequence 1 ttgacagctagctcagtcctaggtactgtgctagctactagagaaagaggagaaatactagatgaacacttcagaacttgaaacccttattcgtaacattttgagtgagcaactt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z