BBa_K519010 1 BBa_K519010 SmtA 2011-09-29T11:00:00Z 2016-01-13T10:24:13Z Synechococcus sp. PCC7942 Released HQ 2013 SmtA is a metallothionein that can bind to heavy metal ions such as Cd(II). This SmtA is cloned from Synechococcus sp. PCC7942 and it has been reported that the cyanobacterial strains that express SmtA can resist medium containing cadmim. false true _684_ 4206 9603 9 In stock false This part was cloned from Synechococcus sp. PCC7942, using primers to add EcoRI, XbaI and SpeI at the ends. false Kotone Miyake BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K519015 1 BBa_K519015 Promoter and RBS with PduP1~18 fused SmtA 2011-09-29T11:00:00Z 2015-05-08T01:12:33Z SmtA was cloned from Synechococcus sp. PCC7942 PduP1~18 fused with cadminium-binding metallothionein SmtA is expressed under a constitutive promoter. false false _684_ 0 9603 9 It's complicated false None false Kotone Miyake component2147859 1 BBa_K519011 component2147850 1 BBa_K519012 annotation2147859 1 BBa_K519011 range2147859 1 122 429 annotation2147850 1 BBa_K519012 range2147850 1 1 115 BBa_K519011 1 BBa_K519011 SmtA-Double Term. 2011-09-29T11:00:00Z 2016-01-13T12:59:12Z Synechococcus sp. PCC7942 SmtA is a metallothionein that can bind to metal ions such as Cd(II). false true _684_ 4206 9603 9 It's complicated false This part is put together with Double terminator. false Kotone Miyake component2147686 1 BBa_B0015 component2147679 1 BBa_K519010 annotation2147686 1 BBa_B0015 range2147686 1 180 308 annotation2147679 1 BBa_K519010 range2147679 1 1 171 BBa_K519012 1 BBa_K519012 Promoter and RBS with PduP1~18 tag 2011-09-29T11:00:00Z 2015-05-08T01:12:33Z Citrobacter Freundii This part constitutes of a PduP protein with the N-terminal ends known to be needed to be taken into Pdu BMC. false false _684_ 0 9603 9 In stock false N-terminal of PduP is expressed under a promoter and RBS false Kotone Miyake annotation2147773 1 BBa_J23102 range2147773 1 1 35 annotation2147774 1 BBa_B0034 range2147774 1 44 55 annotation2147775 1 protein range2147775 1 62 115 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K519012_sequence 1 ttgacagctagctcagtcctaggtactgtgctagctactagagaaagaggagaaatactagatgaacacttcagaacttgaaacccttattcgtaacattttgagtgagcaactt BBa_K519011_sequence 1 atgacctcaacaacgttggtcaaatgcgcttgtgagccctgtctctgcaacgtcgatcccagcaaagcgatcgatcgcaacggtctgtactactgcagcgaagcctgtgccgatggccacaccggtggtagcaaaggctgcggccacaccggctgtaactgccacggctaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K519015_sequence 1 ttgacagctagctcagtcctaggtactgtgctagctactagagaaagaggagaaatactagatgaacacttcagaacttgaaacccttattcgtaacattttgagtgagcaactttactagatgacctcaacaacgttggtcaaatgcgcttgtgagccctgtctctgcaacgtcgatcccagcaaagcgatcgatcgcaacggtctgtactactgcagcgaagcctgtgccgatggccacaccggtggtagcaaaggctgcggccacaccggctgtaactgccacggctaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K519010_sequence 1 atgacctcaacaacgttggtcaaatgcgcttgtgagccctgtctctgcaacgtcgatcccagcaaagcgatcgatcgcaacggtctgtactactgcagcgaagcctgtgccgatggccacaccggtggtagcaaaggctgcggccacaccggctgtaactgccacggctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z