BBa_K519010 1 BBa_K519010 SmtA 2011-09-29T11:00:00Z 2016-01-13T10:24:13Z Synechococcus sp. PCC7942 Released HQ 2013 SmtA is a metallothionein that can bind to heavy metal ions such as Cd(II). This SmtA is cloned from Synechococcus sp. PCC7942 and it has been reported that the cyanobacterial strains that express SmtA can resist medium containing cadmim. false true _684_ 4206 9603 9 In stock false This part was cloned from Synechococcus sp. PCC7942, using primers to add EcoRI, XbaI and SpeI at the ends. false Kotone Miyake BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K519022 1 BBa_K519022 Promoter(High) and RBS with SmtA 2011-10-27T11:00:00Z 2015-05-08T01:12:33Z Synechococcus sp. PCC7942 This part consists of a high constitutive promoter expressing SmtA protein without PduP1-18. false false _684_ 0 9603 9 Not in stock false none false Kotone Miyake component2160948 1 BBa_K519010 component2160947 1 BBa_B0034 component2160955 1 BBa_B0015 component2160945 1 BBa_J23100 annotation2160948 1 BBa_K519010 range2160948 1 62 232 annotation2160955 1 BBa_B0015 range2160955 1 241 369 annotation2160947 1 BBa_B0034 range2160947 1 44 55 annotation2160945 1 BBa_J23100 range2160945 1 1 35 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_K519022_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaatactagatgacctcaacaacgttggtcaaatgcgcttgtgagccctgtctctgcaacgtcgatcccagcaaagcgatcgatcgcaacggtctgtactactgcagcgaagcctgtgccgatggccacaccggtggtagcaaaggctgcggccacaccggctgtaactgccacggctaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K519010_sequence 1 atgacctcaacaacgttggtcaaatgcgcttgtgagccctgtctctgcaacgtcgatcccagcaaagcgatcgatcgcaacggtctgtactactgcagcgaagcctgtgccgatggccacaccggtggtagcaaaggctgcggccacaccggctgtaactgccacggctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z