BBa_K523000 1 BBa_K523000 Plac + lacZ; with BglII site 2011-06-27T11:00:00Z 2015-05-08T01:12:33Z Based on part BBa_J33207, which was amplified from E. coli BL21 genomic DNA using primers based on published sequence (Genbank accession J01636, gi:146575). Released HQ 2013 This is based on part BBa_J33207. Like that part, it encodes the lac promoter and the N-terminal 76 amino acid residues of LacZ, which produce a peptide that complements the lacZ-delta-M15 mutation in common lab strains of ''E. coli''. If grown on Xgal and IPTG, colonies with this part will be blue. The first four bases of the sequence add a BglII site (BglII sites have 6 bases, but the first 2 are provided by the standard BioBrick prefix). This enables an easy method of using PCR to create new BioBricks (e.g. from natural sources): the forward primer for the new BioBrick should have a BglII site added, and the reverse primer should have a SpeI site added. The PCR product and the plasmid containing this part can then both be digested with BglII and SpeI. After mixing and ligation, plasmids that have successfully gained the new BioBrick will be white, while those still containing the lacZ part will be blue (on Xgal+IPTG plates). One might ask: why not use the standard flanking BioBrick sites XbaI and SpeI for this procedure? The answer is that these produce compatible sticky ends and so, upon digestion, the new part will circularise. false false _688_ 0 8799 9 In stock true Note that the BglII (agatct) site overlaps the BioBrick prefix. Since the prefix ends "ag", only "atct" is included in the BioBrick proper. false Chris French, Allan Crossman, Sylvia Ispasanie annotation2122805 1 BglII range2122805 1 1 4 annotation2122808 1 CAP binding site range2122808 1 204 241 annotation2122810 1 -10 range2122810 1 276 281 annotation2122811 1 LacI binding site range2122811 1 288 308 annotation2123637 1 ATG range2123637 1 326 326 annotation2122806 1 rbs range2122806 1 315 318 annotation2123638 1 TGA range2123638 1 554 554 annotation2122809 1 -35 range2122809 1 253 258 annotation2122807 1 LacZ' range2122807 1 326 556 BBa_K523000_sequence 1 atctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtgaaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z