BBa_K523021 1 BBa_K523021 pVIII periplasmic localisation signal (for BioSandwich) 2011-09-14T11:00:00Z 2015-05-08T01:12:34Z PCR of M13 genome. This is the pVIII localisation signal in BioSandwich format. false false _688_ 0 8799 9 It's complicated false . false Sylvia Ispasanie, Mun Ching Lee annotation2129020 1 GG range2129020 1 74 75 annotation2129018 1 pVIII leader range2129018 1 5 73 annotation2129019 1 BglII range2129019 1 1 4 BBa_K523021_sequence 1 atctatgaaaaagtctttagtcctcaaagcctctgtagccgttgctaccctcgttccgatgctgtctttcgctgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z