BBa_K524002 1 BBa_K524002 pLac + RBS+ split sfGFP11 + double terminator 2011-09-27T11:00:00Z 2015-05-08T01:12:34Z A RBS was added to the front of the CDS to drive the translation of sfGFP1-10 (to be entered) false false _689_ 0 8758 9 It's complicated true Constructed from 2011 iGEM DNA Repository Plates and Boxes, Spring Distribution, BBa_I746908 false Trevor Y. H. Ho annotation2146625 1 R0010 range2146625 1 1 200 annotation2146629 1 stop codon range2146629 1 301 306 annotation2146631 1 B0012 range2146631 1 403 443 annotation2146627 1 start codon range2146627 1 226 228 annotation2146626 1 B0034 range2146626 1 208 219 annotation2146630 1 B0010 range2146630 1 315 394 annotation2146628 1 sfGFP11 range2146628 1 229 306 BBa_K524002_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagaaaagaggagaaatactagatgcgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaatgatgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z