BBa_K524007 1 BBa_K524007 RBS+ split sfGFP 11 + double terminator 2011-10-03T11:00:00Z 2015-05-08T01:12:34Z Constructed from 2011 iGEM DNA Repository Plates and Boxes, Spring Distribution, BBa_I746908 The split sfGFP11 was constructed from an pBAD driven sfGFP BBa_I746908. This part is just the CDS of the spilt sfGFP 11. false false _689_ 0 8756 9 In stock false This is just the CDS of the split sfGFP11, making it easy for further modifications if necessary false HO Yuan Heng Trevor annotation2153104 1 B0034 range2153104 1 1 12 annotation2153107 1 stop codon range2153107 1 94 99 annotation2153106 1 sfGFP11 range2153106 1 19 99 annotation2153105 1 start codon range2153105 1 19 21 annotation2153108 1 B0010 range2153108 1 108 187 annotation2153109 1 B0012 range2153109 1 196 236 BBa_K524007_sequence 1 aaagaggagaaatactagatgcgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaatgatgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z