BBa_K524204 1 BBa_K524204 pTE 2012-08-25T11:00:00Z 2015-05-08T01:12:34Z The pTE plasmid was formerly the BBa_S05033 insert that resided in pSB1A2, which was excised out with XbaI and SpeI, and then self-ligated to generate the plasmid. pTE is a template plasmid for generating linear DNA substrate for E. coli homologous recombination through lambda RED recombination system. The plasmid only contain the kanamycin resistant gene and the R6K origin of replication. In using lambda RED recombination, a linear piece of dsDNA is necessary and serves as the substrate for homologous recombination. Such linear dsDNA (in which flanking regions of homologies are incorporated by extending primers used) is usually amplified from a plasmid with a resistance gene as the marker. During purification of the amplicon, plasmids serving as templates can easily contaminate the linear dsDNA, and they would give false positives during isolation of recombinants. (Datsenko and Wanner) To avoid this problem, Datsenko and Wanner introduced a plasmid pKD3 with R6K origin of replication that only allows propagation in permissive host with pi protein provided in trans. Such template plasmids will not propagate in the designated hosts for recombination. The pTE plasmid is a direct mimicking of the pKD4 plamsmid by using available parts from the Registry, for the purpose of generating linear dsDNA that contamination by template plasmid would not cause a problem The necessity for using pTE to amplify linear DNA substrate lies in the fact that template plasmids false false _689_ 0 8758 9 Not in stock false Lox or FRT sites were not included in this plasmid, partly because no qualified BioBricks were available (functionality of parts for lox66 and lox71 were questioned, and FRT sites were not available from DNA Kit Plates). false HO Yuan Heng Trevor annotation2181035 1 BBa_J61001 range2181035 1 976 1381 annotation2181038 1 BBa_P1003 range2181038 1 1 967 annotation2181037 1 Scar range2181037 1 968 975 annotation2181036 1 Scar range2181036 1 1382 1389 BBa_K524204_sequence 1 ctgatccttcaactcagcaaaagttcgatttattcaacaaagccacgttgtgtctcaaaatctctgatgttacattgcacaagataaaaatatatcatcatgaacaataaaactgtctgcttacataaacagtaatacaaggggtgttatgagccatattcaacgggaaacgtcttgctcccgtccgcgcttaaactccaacatggacgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgcttgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtccgtctcaactggctgacggagtttatgcctctcccgaccatcaagcattttatccgtactcctgatgatgcgtggttactcaccaccgcgattcctgggaaaacagccttccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggccgtgttcctgcgccggttacattcgattcctgtttgtaattgtccttttaacagcgatcgtgtatttcgtcttgctcaggcgcaatcacgcatgaataacggtttggttgatgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtctggaaagaaatgcacaagctcttgccattctcaccggattcagtcgtcactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgggtcggaatcgcagaccgttaccaggaccttgccattctttggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaataatactagagtgattcgcacgggcccatggctaattcccatgtcagccgttaagtgttcctgtgtcactcaaaattgctttgagaggctctaagggcttctcagtgcgttacatccctggcttgttgtccacaaccgttaaaccttaaaagctttaaaagccttatatattcttttttttcttataaaacttaaaaccttagaggctatttaagttgctgatttatattaattttattgttcaaacatgagagcttagtacgtgaaacatgagagcttagtacgttagccatgagagcttagtacgttagccatgagggtttagttcgttaaacatgagagcttagtacgttaaacatgagagcttagtacgtgaaacatgagagcttagtacgtactatcaacaggttgaactgctactagag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z