BBa_K526000 1 BBa_K526000 Pompc promoter coding fimE 2011-09-25T11:00:00Z 2015-05-08T01:12:35Z Both fimE and Pompc was amplified from E. coli genomic DNA. Ham, T.S., Lee, S.K., Keasling, J.D. and Arkin, A.P. A tightly regulated inducible expression system utilizing the fim inversion recombination switch. Biotechnology and Bioengineering 94 (2006), pp. 1-4. Pompc is a promoter sequence that is regulated by the famous hybrid light receptor Cph8. fimE is a invertase,by function,that is capable of inverting any DNA sequence that is flanked by fimE recognition site. When fimE recognition sequences are flanked to a promoter element we can ensure that there is no leaky expression as the promoter is in a reverse orientation thus, fim inversion promoters ensures that there is no leaky expression. The hybrid light receeptor Cph8 mediated regulation of gene expression suffers from a high leaky expression. Hence, we made an attempt to reduce the leaky level of the light mediated gene expression systems by using a combination of light receptor and fimE processor. In this biobrick part, we have made an attempt to regulate the expression of fimE based on light so that we could precisely turn on a previously uninduced gene . This system would ensure more tight control of target gene expression. This combination would be potentially useful for toxic gene expression. false false _692_ 0 8432 9 It's complicated false There is no special design consideration. We can amplify the Pompc and fimE from E. coli genomic DNA and assembly them usingon's Assembly. false Sung Kuk Lee annotation2150055 1 Pompc range2150055 1 1 117 annotation2150037 1 fimE range2150037 1 118 757 BBa_K526000_sequence 1 ggccatggtcccttgcatttacattttgaaacatctatagcgataaatgaaacatcttaaaagttttagtatcatattcgtgttggattattctgcatttttggggagaatggacttactagagtcacacaggacggccgatgaagaataaggctgataacaaaaaaaggaacttcctgacccatagtgaaatcgaatcactccttaaagcagcaaataccgggcctcatgcagcacgtaattattgtctgactttgctttgttttattcatggtttccgggcgagtgaaatttgtcgattgaggatttcggatattgatcttaaggcaaagtgtatatatatccatcgattaaaaaaaggcttttcaacaacgcacccgctattgaataaagaagttcaggctttaaaaaactggttgagtatccgtacttcgtacccgcatgctgagagcgagtgggtatttttatcacgtaaggggaatccgctttctcggcaacagttttaccatattatctcgacttccggtggtaatgccgggttgtcactggagattcatccgcacatgttacgccattcgtgtggttttgctttggcgaatatgggaatagatacgcgacttatccaggattatcttgggcatcgcaatattcgtcatactgtctggtataccgccagcaatgcagggcgtttttacggcatctgggatagagccagaggacgacagcgtcacgctgttttatagtgataagaattcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z