BBa_K526002 1 BBa_K526002 Temperature dependent Ribo-Switch fused to GFP 2011-09-25T11:00:00Z 2015-05-08T01:12:35Z Oleksiuk, O., Jakovljevic, V., Vladimirov, N., Carvalho, R., Paster, E., Ryu, William??S., Meir, Y., Wingreen, Ned??S., Kollmann, M. and Sourjik, V. Thermal Robustness of Signaling in Bacterial Chemotaxis. Cell 145 (2011), pp. 312-321. We have exploited the temperature dependent mRNA that is associated with the chemotaxis response regulator, CheR, to develop a novel temperature regulated gene expression system. The mRNA is assumed to form a stable secondary structure burrying the RBS and thus blocking gene expression at a higher temperature (37 degree C) where as the temperature is lowered to about 27 degree C the stability of the secondary structure is disturbed thus exposing the RBS and favoring gene expression false false _692_ 0 8432 9 It's complicated true We removed the start codon and the second codon present in the mRNA and fused it directly to GFP. The removal of the last two codons of the mRNA might have some effect on the secondary structure stability false Sung Kuk Lee annotation2149304 1 GFP range2149304 1 111 807 annotation2149303 1 Riboswitch range2149303 1 1 110 BBa_K526002_sequence 1 tttcgtcgcgtgtggcggtatttacccttgaagaacatgaagtagcacgacatgagtcggtgcagttacaaattgcgccagtggtatcctgaagtgattgagaaggcgctatgagtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttctcttatggtgttcaatgcttttcccgttatccggatcatatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggaactacaagacgcgtgctgaagtcaagtttgaaggtgatacccttgttaatcgtatcgagttaaaaggtattgattttaaagaagatggaaacattctcggacacaaactggagtacaactataactcacacaatgtatacatcacggcagacaaacaaaagaatggaatcaaagctaacttcaaaattcgccacaacattgaagatggatccgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagcgtgaccacatggtccttcttgagtttgtaactgctgctgggattacacatggcatggatgagctctacaaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z