BBa_I746916 1 BBa_I746916 superfolder GFP coding sequence 2008-09-29T11:00:00Z 2015-08-31T04:08:05Z Superfolder GFP was originally described by: Pedelacq et al (2006): "Engineering and characterization of a superfolder green fluorescent protein", Nature Biotech 24 (1) January 2006 This version was synthesised de novo (by Geneart). This is the coding sequence of superfolder GFP (Pedelacq et al (2006): "Engineering and characterization of a superfolder green fluorescent protein", Nature Biotech 24 (1) January 2006). It carries the following amino acid changes with respect to mut3 GFP (E0040), the currently most commonly used GFP in the registry: S30R, Y39N, F64L, G65T, F99S, N105T, Y145F, M153T, V163A, I171V, A206V Its in-vivo properties are considerably improved with respect to mut3 - it develops fluorescence about 3fold faster than mut3 GFP and reaches 4fold higher absolute fluorescence levels. Fluorescenct colonies can be identified with the naked eye even without UV or blue light illumination (that is to say the amount of blue light in normal daylight or lablight is sufficient). Additionally it is more stable in vitro and refolds faster after in vitro denaturation with respect to mut3 GFP. Note: Superfolder GFP is available in constructs driven by the pBAD and T7 promoters: part numbers I746908 and I746909 respectively. Additionally 6-his tagged versions for protein purification exist: I746914 (pBAD driven) and I746915 (T7 driven). false false _116_ 0 2122 9 It's complicated false Codon optimisation before de novo synthesis was carried out for both, E.coli and Bacillus subtilis. false Stefan Milde annotation1977535 1 stop range1977535 1 715 720 annotation1977533 1 start range1977533 1 1 3 annotation1977534 1 superfolder GFP coding region range1977534 1 1 720 BBa_K299504 1 BBa_K299504 Expression vector J23100+B0034 2010-08-12T11:00:00Z 2015-05-08T01:11:50Z Released HQ 2013 false false _419_ 0 7677 9 In stock true false Micha&#322; Lower component2077714 1 BBa_J23100 component2077716 1 BBa_B0034 annotation2077714 1 BBa_J23100 range2077714 1 1 35 annotation2077716 1 BBa_B0034 range2077716 1 44 55 BBa_K528014 1 BBa_K528014 RBS measurement device J23100 B0034 Super Folder GFP 2011-09-17T11:00:00Z 2015-05-08T01:12:35Z The device consists of BBa_K299504 expression vector J23100+B0034. BBa_I746916 SF-GFP was used as reporter protein. This device was used to determine BBa_B0034 strength as a standard measurement. false false _694_ 0 10330 9 Not in stock true No false El&#380;bieta Jankowska component2132319 1 BBa_K299504 component2132323 1 BBa_I746916 annotation2132323 1 BBa_I746916 range2132323 1 62 781 annotation2132319 1 BBa_K299504 range2132319 1 1 55 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0034_sequence 1 aaagaggagaaa BBa_K299504_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaa BBa_I746916_sequence 1 atgcgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtttacatcaccgccgataaacaaaaaaatggcattaaagcgaattttaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaatgatga BBa_K528014_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaatactagatgcgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtttacatcaccgccgataaacaaaaaaatggcattaaagcgaattttaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaatgatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z