BBa_K528017 1 BBa_K528017 Expression Adapter s02_20k 2011-09-18T11:00:00Z 2015-05-08T01:12:35Z gaattccgcggccgcttctagattgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaatgactatgattgccaccattatccagaccggttaatactagtagcggccgctgcag To make strength of RBS parts truly standard we propose using something we call expression adapters ??? short, 130 base pairs long sequences consisting of a promoter, RBS, 5 bp spacer and a short, 10 amino acid long protein. 20k is strength in Voigth's virtual units. false false _694_ 0 10294 9 It's complicated true Spacer and short protein were created by a genetic algorithm that we designed specifically for this task. It generates random 5 bp spacers and 10 amino acid long proteins. Proteins consist of only 11 amino acids, those that does not direct to the N- degradation pathway [1]. Genetic algorithm was used because there is too many combinations of random spacers and 10 aa proteins to test them all. First generation of spacers and proteins is submitted to several rounds of random mutations and recombination. The outcome sequences from all the rounds of genetic alterations were then gathered in one list. After removal of the duplicates sequences were scored using RBS calculator ??? an algorithm developed by Christopher A. Voigt [2]. The calculator considers parameters like fold of the protein, complementarity with the ribosome and... Each adapter sequence is modeled with several fluorescent proteins including GFP, SF-GFP, YFP, mORANGE and RFP. Those with the best score are then processed with another tool that chooses adapters with the best expression levels and low deviations between different proteins. From the final forty sequences six adapters providing six different levels of expression were chosen manually and synthesized in Laboratory of DNA Sequencing and Oligonucleotide Synthesis in the Institute of Biochemistry and Biophysics, Polish Academy of Sciences (Warsaw, Poland). The final step was to test them in the wet lab. false Pawel Urbanski BBa_K528017_sequence 1 attgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaatgactatgattgccaccattatccag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z