BBa_K530013 1 BBa_K530013 PRY1 Yeast UTR 2011-09-02T11:00:00Z 2015-05-08T01:12:35Z http://www.yeastgenome.org/cgi-bin/locus.fpl?locus=PRY1 PRY1 yeast UTR is used to regulate the expression of genes within the genome of Saccharomyces Cerevisiae or baker's yeast. false false _696_ 0 8447 9 Not in stock false UTR was extracted from purified genomic DNA from Saccharomyces Cerevisiae. The PCR reaction performed also served to add the biobrick prefix and suffix to the UTR. false Daniel Wolozny annotation2125808 1 PRY1 UTR range2125808 1 1 165 BBa_K530013_sequence 1 ctttcaagaaaagttttcattgatccttctttctcattccttcatttaatgttcgttttatcttcattgttttacgaggatttttctgcttcagcagttccttgttcactaagtatacccatatatacccgcctatataccccaatttttttatacagtaacgaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z