BBa_K530017 1 BBa_K530017 FCY2 Yeast UTR 2011-09-02T11:00:00Z 2015-05-08T01:12:35Z http://www.yeastgenome.org/cgi-bin/locus.fpl?locus=FCY2 FCY2 yeast UTR is used to regulate the expression of genes within the genome of Saccharomyces Cerevisiae or baker's yeast. false false _696_ 0 8447 9 It's complicated false UTR was extracted from purified genomic DNA from Saccharomyces Cerevisiae. The PCR reaction performed also served to add the biobrick prefix and suffix to the UTR. false Daniel Wolozny annotation2125812 1 FCY2 UTR range2125812 1 1 100 BBa_K530017_sequence 1 gaagtaatgattagggcgatcatttccccgtgcacatttcacgtcatgtatcatagatgcaatttcatgtaaactatttagacatctcatttaataaaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z