BBa_K530019 1 BBa_K530019 HHO1 Yeast UTR 2011-09-02T11:00:00Z 2015-05-08T01:12:35Z http://www.yeastgenome.org/cgi-bin/locus.fpl?locus=HHO1 Released HQ 2013 HHO1 yeast UTR is used to regulate the expression of genes within the genome of Saccharomyces Cerevisiae or baker's yeast. false false _696_ 0 8447 9 In stock true UTR was extracted from purified genomic DNA from Saccharomyces Cerevisiae. The PCR reaction performed also served to add the biobrick prefix and suffix to the UTR. false Daniel Wolozny annotation2125815 1 HHO1 UTR range2125815 1 1 312 BBa_K530019_sequence 1 aaagtgaatatccaaacgagaatgtcaatggtgatagcaatactatcaaacctattttctttcttcatttttgtgtcccatcactattagtattttgtattatttctaaatttttttctctctaattttcaatcttattcaagtgtttgttggcggtactgtaaattttcattttttaatctctcccttctctatttgttacttattcggtaaatatctcctttatgattttattcaaattccattcttaactaactaactatactgtttataaatttctcttctcttatatatgcaaggtacagtgtgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z