BBa_K530020 1 BBa_K530020 ARD1 Yeast UTR 2011-09-02T11:00:00Z 2015-05-08T01:12:35Z http://www.yeastgenome.org/cgi-bin/locus.fpl?locus=ARD1 ARD1 yeast UTR is used to regulate the expression of genes within the genome of Saccharomyces Cerevisiae or baker's yeast. false false _696_ 0 8447 9 It's complicated true UTR was extracted from purified genomic DNA from Saccharomyces Cerevisiae. The PCR reaction performed also served to add the biobrick prefix and suffix to the UTR. false Daniel Wolozny annotation2125816 1 ARD1 UTR range2125816 1 1 83 BBa_K530020_sequence 1 ttaaatcaacctatataaacgtagtatattttcatccaggcttcttcacaagctctgttagctctttttgagcacggttctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z