BBa_K530023 1 BBa_K530023 TDH3 Yeast UTR 2011-09-02T11:00:00Z 2015-05-08T01:12:35Z http://www.yeastgenome.org/cgi-bin/locus.fpl?locus=TDH3 KRE9 Promoter is used to regulate the expression of genes within the genome of Saccharomyces Cerevisiae or baker's yeast. false false _696_ 0 8447 9 Not in stock false Promoter was extracted from purified genomic DNA from Saccharomyces Cerevisiae. The PCR reaction performed also served to add the biobrick prefix and suffix to the promoter. false Daniel Wolozny annotation2125821 1 TDH3 UTR range2125821 1 1 100 BBa_K530023_sequence 1 gtgaatttactttaaatcttgcatttaaataaattttctttttatagctttatgacttagtttcaatttatatactattttaatgacattttcgattcat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z