BBa_K531002 1 P<sub>xyl< P_xyl: Inducible promoter and RBS from <i>Caulobacter crescentus</i> 2011-07-03T11:00:00Z 2015-05-08T01:12:36Z Meisenzahl, A., Shapiro, L., Jenal, U. Isolation and Characterization of a Xylose-Dependent Promotor from Caulobacter crescentus. Feb. 1997, Journal of Bacteriology 179(3), 592-600. This is an inducible promotor for the gene xylX found in Caulobacter crescentus. false false _697_ 0 9994 9 In stock false No design difficulties false Nora Kostow BBa_K531002_sequence 1 gcggcttctagcatggaccgcccgcgcccgtgaggccgaggatttcgcgctggtcagacaacctacttgccgtccccacatgttagcgctaccaagtgccgacgaacgcgcgccgccgacggtgtcggcgcttcagacgctcgagttttggggaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z