BBa_K533001 1 BBa_K533001 OmpA-SH3 2011-09-28T11:00:00Z 2015-05-08T01:12:36Z OmpA is derived from the genomic DNA of BL21 (DE3) E. Coli strain while SH3 is from human Grb2. This part contains the N-terminal 180 amino acids of OmpA fused to SH3 domain in human Grb2 protein. The N-terminal of OmpA allows the moiety fused to it to be presented on to the outer membrane of E. Coli. SH3 domain allows for binding to multi-proline peptide in human cells, which functions as a crucial adaptor module in signaling. In our part, this is specially for binding to the proteins for transportation by E. Coli. All the coding sequence is under T7 promoter and lac repressor binding site. The parts is most efficiently presented onto the membrane when induced at 0.1mM IPTG at 18 centigrade in BL21 E. Coli strain. false false _699_ 0 6884 9 It's complicated false High expression efficiency as well as inducible expression is most desirable when considering a coding sequence. false ZHANG Yunxiao annotation2150406 1 lac operator range2150406 1 20 44 annotation2150408 1 OmpA range2150408 1 87 632 annotation2150407 1 T7 promoter range2150407 1 1 18 annotation2150409 1 SH3 range2150409 1 633 815 BBa_K533001_sequence 1 taatacgactcactataggggaattgtgagcggataacaattccccctagtaataattttgtttaactttaagaaggagatataccatggcaatgaaaaagacagctatcgcgattgcagtggcactggctggtttcgctaccgtagcgcaggccgctccgaaagataacacctggtacactggtgctaaactgggctggtcccagtaccatgacactggtttcatcaacaacaatggcccgacccatgaaaaccaactgggcgctggtgcttttggtggttaccaggttaacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcgttgaaaacggtgcatacaaagctcagggcgttcaactgaccgctaaactgggttacccaatcactgacgacctggacatctacactcgtctgggtggcatggtatggcgtgcagacactaaatccaacgtttatggtaaaaaccacgacaccggcgtttctccggtcttcgctggcggtgttgagtacgcgatcactcctgaaatcgctacccgtctggaataccagtggaccaacaacatcggtgacgcacacaccatcggcactcgtccggacaacatggaagccatcgccaaatatgacttcaaagctactgcggacgacgagctgagcttcaaaaggggggacatcctcaaggttttgaacgaagaatgtgatcagaactggtacaaggcagagcttaatggaaaagacggcttcattcccaagaactacatagaaatgaaaccacatccgtggtaggatccggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z