BBa_K535003 1 BBa_K535003 FeOx -> Clostridium acetobutylicum???s ferredoxin 2011-09-24T11:00:00Z 2015-05-08T01:12:36Z This sequence was copied from the ferredoxin gene encoded in C. acetobutylicum???s genome. Ferredoxins are small soluble proteins that contain iron-sulfur clusters and that usually mediate electron transfer in a range of metabolic reactions. Their iron-sulfur clusters contain iron and sulfur atoms organized, the iron atoms can change in the oxidation state (+2 or +3) and in that way accept or discharge electrons. Thus, ferredoxins act as electron transfer agents in biological redox reactions. In this case we use this Clostridium acetobutylicum???s ferredoxin to transfer electrons to a linked hydrogenase from the same organism. PFOR should oxidize pyruvate to acetyl-CoA and then reduce the ferrodoxin so it can transfer the electron. false false _701_ 0 8698 9 Not in stock false Some codons of the original Clostridium acetobutylicum FeOx sequence have been changed for synonimous ones according to the Codon Adaptation Index (CAI) procedure with respect to Rhizobium etli CFN42 codon usage in order to optimize its expression and to optimize R. etli CFN42???s (where we will express this gene) fitness as well. The Codon adaptation Index indicates how similar the Codon Usage (CU) in a coding sequence (CDS) is to that of highly/constitutively expressed genes. It is not a cause of high gene expression, but it is necessary to optimize resource usage. To optimize a sequence according to the CAI procedure we first obtained relative adaptiveness (w) for each codon (1.- most frequent codon. 0.- non-existent codon) in R. etli and then we substitute codons in target CDS for all synonymous codons with greatest w. In our final construction (part ####) we coupled this sequence with the N-terminus hydA gene (part ####) using a flexible glycine/serine-rich linker of 14 aminoacid long in order to make the electron transfer more efficient. At the end we added a poly-His region so we can make an immuno-assay to verify that the whole construction is being exported to the periplasm, this tag is flanked by two AatII restriction sites so we can split it out if needed. We also added a double TAA terminator. The whole construction is regulated by the NifH promoter region (part ###) so it will be transcribed under microaerobic conditions. This part was synthesized. false iGEM11_UNAM-Genomics_ Mexico annotation2139563 1 double TAA stop range2139563 1 241 246 annotation2139562 1 poly His tag range2139562 1 211 240 annotation2139561 1 FeOx range2139561 1 43 210 annotation2139560 1 linker range2139560 1 1 42 BBa_K535003_sequence 1 ggcggcggctcgggcggcggcggctcgggcggcggcggctcgatggcctataagatcaccgacgcctgcgtctcgtgcggctcgtgcgcctcggagtgcccggtctcggccatctcgcagggcgacacccagttcgtcatcgacgccgacacctgcatcgagtgcggcaactgcgccaacgtctgcccggtcggcgccccggtccaggagaagcttcatcatcatcatcatcataagctttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z