BBa_K537000 1 atRS-ChZ Atrazine Riboswitch-CheZ fusion 2011-07-18T11:00:00Z 2015-05-08T01:12:36Z The CheZ gene was isolated from genomic DNA using PCR where the forward primers in the reaction contained the sequence for the atrazine riboswitch. This DNA part will encode for an RNA riboswitch senstive to atrazine. The riboswitch, when no atrazine is present, prevents the exposure of the RBS. When atrazine is present, it binds to the riboswitch exposing the RBS and allows for the translation of the adjoining gene. In this case, the gene which will be expressed is CheZ, which a protein fundamental to bacterial movement. false false _703_ 0 9307 9 It's complicated false The effectiveness of the atrazine riboswitch is determined by the ability of the RNA 'loop' to hide the RBS preventing translation. The sequence of bases within the riboswitch will determine the formation of the loop and its leakiness. false Natasia Kruger annotation2134324 1 start range2134324 1 86 88 annotation2134322 1 Atrazine riboswitch range2134322 1 1 88 annotation2134323 1 C -> T range2134323 1 55 55 annotation2134325 1 CheZ range2134325 1 86 727 BBa_K537000_sequence 1 gggacagggctagcatgaggcggggtaaaattgctccgataaaaacgcaaagtcttgcaggtcgacgccagggtggaacaacaagatgatgcaaccatcaatcaaacctgctgacgagcattcagctggcgatatcattgcgcgcatcggcagcctgacgcgtatgctgcgcgacagtttgcgggaactggggctggatcaggccattgccgaagcggcggaagccatccccgatgcgcgcgatcgtttgtactatgttgtgcagatgaccgcccaggctgcggagcgggcgctgaacagtgttgaggcgtcacaaccgcatcaggatcaaatggagaaatcagcaaaagcgttaacccaacgttgggatgactggtttgccgatccgattgaccttgccgacgcccgtgaactggtaacagatacacgacaatttctggcagatgtacccgcgcataccagctttactaacgcgcaactgctggaaatcatgatggcgcaggattttcaggatctcaccgggcaggtcattaagcggatgatggatgtcattcaggagatcgaacgccagttgctgatggtgctgttggaaaacatcccggaacaggagtcgcgtccaaaacgtgaaaaccagagtttgcttaatggacctcaggtcgataccagcaaagccggtgtggtagccagtcaggatcaggtggacgatttgttggatagtcttggattt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z