BBa_K537001 1 thRS1-ChZ Theophylline Riboswitch 1-CheZ 2011-07-18T11:00:00Z 2015-05-08T01:12:36Z The CheZ gene was isolated from genomic DNA using PCR where the forward primers in the reaction contained the sequence for the theophylline riboswitch. This DNA part will encode for an RNA riboswitch senstive to theophylline. The riboswitch, in the absence of theophylline, prevents the exposure of the RBS. When theophylline is present, it binds to the riboswitch exposing the RBS and allows for the translation of the adjoining gene. In this case, the gene which will be expressed is CheZ, which a protein fundamental to bacterial movement. false false _703_ 0 9307 9 In stock true The effectiveness of the theophylline riboswitch is determined by the ability of the RNA 'loop' to hide the RBS preventing translation. The sequence of bases within the riboswitch will determine the formation of the loop and its leakiness. false Natasia Kruger annotation2127173 1 CheZ range2127173 1 57 698 annotation2127170 1 Aptamer range2127170 1 1 26 annotation2127172 1 rbs range2127172 1 47 49 annotation2127174 1 start range2127174 1 57 59 annotation2127171 1 Theophylline riboswitch (type 1) range2127171 1 1 59 BBa_K537001_sequence 1 ggtgataccagcatcgtcttgatgcccttggcagcaccccgctgcaagacaacaagatgatgcaaccatcaatcaaacctgctgacgagcattcagctggcgatatcattgcgcgcatcggcagcctgacgcgtatgctgcgcgacagtttgcgggaactggggctggatcaggccattgccgaagcggcggaagccatccccgatgcgcgcgatcgtttgtactatgttgtgcagatgaccgcccaggctgcggagcgggcgctgaacagtgttgaggcgtcacaaccgcatcaggatcaaatggagaaatcagcaaaagcgttaacccaacgttgggatgactggtttgccgatccgattgaccttgccgacgcccgtgaactggtaacagatacacgacaatttctggcagatgtacccgcgcataccagctttactaacgcgcaactgctggaaatcatgatggcgcaggattttcaggatctcaccgggcaggtcattaagcggatgatggatgtcattcaggagatcgaacgccagttgctgatggtgctgttggaaaacatcccggaacaggagtcgcgtccaaaacgtgaaaaccagagtttgcttaatggacctcaggtcgataccagcaaagccggtgtggtagccagtcaggatcaggtggacgatttgttggatagtcttggattt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z