BBa_K538000 1 Cpn10 Cpn10 (O. antarctica) 2011-07-27T11:00:00Z 2015-05-08T01:12:36Z ''De novo'' synthesis Released HQ 2013 This part encodes the protein ''cochaperonin 10'', which is part of the Cpn10/Cpn60 chaperonin system of ''Oleispira antarctica''. [More information will follow soon.] false false _704_ 0 9985 9 In stock true The protein's sequence[1] was published by Ferrer ''et al.'' in 2004. Pre- and suffixes were added to this as clarified in OpenWetWare's BioBrick standards[2] and, as is recommended, the TAA stop codon was replaced with TAATAA. The sequence's conformity with Assembly standard 10[3] was confirmed using the EMBOSS recoder[4], by recoding restriction sites of EcoRI, XbaI, SpeI, PstI, NotI, PvuII, XhoI, AvrII, NheI and SapI. 1 - http://www.ncbi.nlm.nih.gov/nuccore/22266159?from=458&to=751&report=gbwithparts 2 - http://openwetware.org/wiki/Biobrick_standard 3 - http://partsregistry.org/Help:Assembly_standard_10 4 - http://bioweb2.pasteur.fr/docs/EMBOSS/recoder.html false Bas Stringer (Sequence by Paul van Dieken) annotation2124175 1 Double Stop Codon range2124175 1 292 297 annotation2124174 1 Start Codon range2124174 1 1 3 BBa_K206000 1 pBAD pBAD strong 2009-10-13T11:00:00Z 2015-05-08T01:11:23Z The sequence was obtained by applying all mutations that upregulated AraC binding and subsequent promoter activity listed in reference [1]. Released HQ 2013 pBAD is an <i>E.coli</i> promoter that is induced by L-arabinose. K206000 is a mutagenized pBAD promoter that is responsive to lower concentrations of arabinose than wild type (<partinfo>I13453</partinfo>) and, additionally, exhibits a higher maximum of protein expression as measured by coupling to a fluorescent reporter. false false _307_ 0 4172 9 In stock true There were no special design considerations. false Amelia Hardjasa annotation2049253 1 AraI1 range2049253 1 40 57 annotation2049252 1 promoter range2049252 1 1 131 annotation2049254 1 AraI2 range2049254 1 61 78 BBa_K538300 1 pBAD:Cpn10 pBAD + RBS + Cpn10 2011-09-07T11:00:00Z 2015-05-08T01:12:37Z - - false false _704_ 0 9985 9 Not in stock false - false Bas Stringer component2126759 1 BBa_K206000 component2126761 1 BBa_B0034 component2126764 1 BBa_K538000 annotation2126764 1 BBa_K538000 range2126764 1 157 453 annotation2126759 1 BBa_K206000 range2126759 1 1 130 annotation2126761 1 BBa_B0034 range2126761 1 139 150 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0034_sequence 1 aaagaggagaaa BBa_K538300_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagctactagagaaagaggagaaatactagatgaaaatccgtccattacatgatcgtattgttgttcgccgtaaagaagaagagaccgcaactgcgggtggtattattttaccgggcgctgcggcagaaaaaccaaatcaaggtgttgttatctctgtgggtactggccgtattcttgataatggttcagtgcaagcgctggcggttaacgaaggcgatgttgtcgtttttggtaaatactcaggtcaaaatactatcgatatcgatggtgaagaattattgattttgaatgaaagtgatatctacggcgttttagaagcttaataa BBa_K206000_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc BBa_K538000_sequence 1 atgaaaatccgtccattacatgatcgtattgttgttcgccgtaaagaagaagagaccgcaactgcgggtggtattattttaccgggcgctgcggcagaaaaaccaaatcaaggtgttgttatctctgtgggtactggccgtattcttgataatggttcagtgcaagcgctggcggttaacgaaggcgatgttgtcgtttttggtaaatactcaggtcaaaatactatcgatatcgatggtgaagaattattgattttgaatgaaagtgatatctacggcgttttagaagcttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z