##gff-version 3
##sequence-region BBa_K539421 1 260
BBa_K539421	.	mature_transcript_region	209	260	.	+	0	ID=BBa_K115002;Name=BBa_K115002
BBa_K539421	.	sequence_alteration	231	236	.	+	0	ID=annotation1966899;Name=scar adaptation;Parent=BBa_K115002
BBa_K539421	.	ribosome_entry_site	255	260	.	+	0	ID=annotation1966897;Name=rbs;Parent=BBa_K115002
BBa_K539421	.	stem_loop	209	226	.	+	0	ID=annotation1966930;Name=stem_loop;Parent=BBa_K115002
BBa_K539421	.	stem_loop	232	260	.	+	0	ID=annotation1966931;Name=predicted stem-loop extending to one position before start codon;Parent=BBa_K115002
BBa_K539421	.	promoter	1	200	.	+	0	ID=BBa_R0010;Name=BBa_R0010
BBa_K539421	.	start_codon	173	173	.	+	0	ID=annotation1961227;Name=start;Parent=BBa_R0010
BBa_K539421	.	non_covalent_binding_site	89	126	.	+	0	ID=annotation1961223;Name=CAP binding site;Parent=BBa_R0010
BBa_K539421	.	engineered_region	1	200	.	+	0	ID=annotation1961222;Name=BBa_R0010;Parent=BBa_R0010
BBa_K539421	.	CDS	1	88	.	+	0	ID=annotation1961221;Name=end of LacI coding region (inactive);Parent=BBa_R0010
BBa_K539421	.	promoter	161	166	.	+	0	ID=annotation1961225;Name=-10;Parent=BBa_R0010
BBa_K539421	.	non_covalent_binding_site	166	200	.	+	0	ID=annotation1961226;Name=LacI binding site;Parent=BBa_R0010
BBa_K539421	.	promoter	137	142	.	+	0	ID=annotation1961224;Name=-35;Parent=BBa_R0010
>BBa_K539421
caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagc
gggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggct
cgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagggacaagcaatgcttgccttgaatagtaa
cttttgaatagtgattcaggagg