BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961227 1 start range1961227 1 173 173 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 BBa_K539421 1 BBa_K539421 promoter (lacI regulated)+RNA thermometer 2011-09-26T11:00:00Z 2015-05-08T01:12:37Z a Released HQ 2013 a false false _705_ 0 10239 9 In stock false a false Shu-Han Chang component2143739 1 BBa_K115002 component2143728 1 BBa_R0010 annotation2143739 1 BBa_K115002 range2143739 1 209 260 annotation2143728 1 BBa_R0010 range2143728 1 1 200 BBa_K115002 1 BBa_K115002 RNA thermometer (FourU) 2008-07-14T11:00:00Z 2015-05-08T01:09:27Z Salmonella Enterica Tyhpy (CP000886.1) Released HQ 2013 Thermo sensitive small RNA (ROSE structure) which can be used as a RNA regulator. false false _223_ 0 3006 9 In stock true Part of the sequence is altered because of the scar... true Bastiaan van den Berg annotation1966899 1 scar adaptation range1966899 1 23 28 annotation1966931 1 predicted stem-loop extending to one position before start codon range1966931 1 24 52 annotation1966930 1 stem_loop range1966930 1 1 18 annotation1966897 1 rbs range1966897 1 47 52 BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_K539421_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagggacaagcaatgcttgccttgaatagtaacttttgaatagtgattcaggagg BBa_K115002_sequence 1 ggacaagcaatgcttgccttgaatagtaacttttgaatagtgattcaggagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z