BBa_K540001 1 BBa_K540001 rcn, cobalt-sensitive promoter 2011-09-14T11:00:00Z 2015-07-14T12:34:23Z PCR from E.coli MC4100 genome. Released HQ 2013 Rcn is a promoter that is activated by cobalt. A repressor is fixed to the promoter by default, and cobalt binds to this repressor, which activates the gene under control of this promoter. Rcn is also activated by nickel, but we have not characterized this aspect. false false _706_ 4206 8419 9 In stock false An internal iGEM restriction site had to be mutated by QuickChange mutagenesis. false Mathilde Dumond annotation2129035 1 RcnR range2129035 1 1 279 BBa_K540001_sequence 1 ttattattatttgatatatgaatccagcaccttcagaacgacatccagatcttcttcacgttttagctcatccccctggtgaacgatgtgttccgtcagatgacctttaatcacttcccgcatcagaccgtttaccgcgccacggatagcagcaatctgttgtaaaactgctgcgcattcgtgcggctcgtcgagcattttcttgagcgccacgacctggccctgaatcttactggcacgcgctttcagtttctgtttatcacggattgtatgagacatggcaacacctggttaacaagaatatgaaaaatcatagcactattaatctactggggggtagtatcaggtactgggggggagtagaatcagattgccgaattaatactaagaattattatcatgaccgaatttacaactcttcttcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z