BBa_K541501 1 BBa_K541501 Promoter Pveg, RBS spoVG and SacB signal peptide for B. subtilis 2011-07-18T11:00:00Z 2015-05-08T01:12:38Z All three basic components come from B.subtilis genome Released HQ 2013 Constitutive promoter veg(BBa_K143012) coupled to the strong Ribosome Binding Site spoVG(BBa_K143021) from B. subtilis. These parts have been taken from 2008_Imperial_Collage. Pveg is a constitutive promoter that constitutively expresses the P43 protein in B. subtilis. SpoVG is an endogenous ribosome binding site from B. subtilis. The sequence of the spoVG ribosome binding site is AAAGGUGGUGA which is complementary to the sequence UUUCCUCCACU from the 3' region of the 16s rRNA from B. subtilis. SacB is a signal peptide used in the Sec-SRP (secretory signal recognition particle) pathway by B. subtilis. Signal peptides are responsible for directing preproteins (secretory proteins with a signal peptide region attached) through an appropriate secretory pathway. In the case of the Sec-SRP signal peptide, they direct preproteins from the cytoplasm into the growth medium. false false _708_ 0 4260 9 In stock false no any design consideration false Cihan TAŞTAN annotation2123459 1 BBa_K143053 range2123459 1 1 117 annotation2123460 1 SacB Signal tag range2123460 1 124 219 annotation2123455 1 Sigma A-35 range2123455 1 63 68 annotation2123457 1 rbs range2123457 1 106 117 annotation2123454 1 BBa_K143012 range2123454 1 1 97 annotation2123458 1 BBa_K143021 range2123458 1 106 117 annotation2123456 1 Sigma A -10 range2123456 1 86 91 BBa_K541501_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgttactagagaaaggtggtgaatactagatgaacatcaaaaaatttgcaaaacaggcgacagttctgacatttacaacagcactgcttgcaggcggcgcaacacaagcatttgcaaaagaaaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z