BBa_K541502 1 BBa_K541502 Promoter Pveg, RBS spoVG and LipA signal peptide for B. subtilis 2011-07-18T11:00:00Z 2015-05-08T01:12:38Z b.subtilis Released HQ 2013 Constitutive promoter veg(BBa_K143012) coupled to the strong Ribosome Binding Site spoVG(BBa_K143021) from B. subtilis. These parts have been taken from 2008_Imperial_Collage. Pveg is a constitutive promoter that constitutively expresses the P43 protein in B. subtilis. SpoVG is an endogenous ribosome binding site from B. subtilis. The sequence of the spoVG ribosome binding site is AAAGGUGGUGA which is complementary to the sequence UUUCCUCCACU from the 3' region of the 16s rRNA from B. subtilis. LipA is a signal peptide from the B. subtilis genome. In general, signal peptides are responsible for directing preproteins (secretory proteins with a signal peptide region attached)through an appropriate secretory pathway[3]. LipA has been successfully used in the secretion of heterologous proteins such as cutinase by B. subtilis. false false _708_ 0 8463 9 In stock false optimized for b.subtilis false Fazilet Guler annotation2123492 1 rbs range2123492 1 106 117 annotation2123494 1 LipA signal peptide range2123494 1 124 225 annotation2123490 1 Sigma A -10 range2123490 1 86 91 annotation2123489 1 Sigma A-35 range2123489 1 63 68 annotation2123493 1 BBa_K143021 range2123493 1 106 117 annotation2123491 1 BBa_K143012 range2123491 1 1 97 BBa_K541502_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgttactagagaaaggtggtgaatactagatgaaatttgtgaaaagacgcattattgcactggttacaattctgatgctgtcagttacatcactgtttgcactgcaaccgtcagcaaaagcagcagaacat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z