BBa_K541503 1 BBa_K541503 Constitutive Strong promoter, Strong RBS and TAT signal peptide 2011-07-18T11:00:00Z 2015-05-08T01:12:38Z E.coli Released HQ 2013 Twin arginine signal peptide is an efficient protein export signal sequence of E. coli. Because of its constitutive character, its promoter works permanently. false false _708_ 0 9573 9 In stock false Optimized for E.coli false Mustafa Elitok annotation2123464 1 conserved range2123464 1 48 51 annotation2123466 1 TAT signaling peptide range2123466 1 62 151 annotation2123465 1 BBa_B0034 range2123465 1 44 55 annotation2123463 1 BBa_J23100 range2123463 1 1 35 BBa_K541503_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaatactagatggacaaattcgacgctaatcgccgcaaattgctggcgcttggtggcgttgcactcggtgccgccatcctgccgacccctgcgtttgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z