BBa_K541515 1 BBa_K541515 Limulus anti-LPS factor (LALF) for Bacillus subtilis 2011-07-12T11:00:00Z 2015-05-08T01:12:38Z Horseshoe crabs (Limulus polyphemus and Tachypleus tridentatus) are ancient arachnids that possess a primitive circulatory system, the hemolymph, containing only one kind of cell, the hemocyte. Exposure of hemocytes to bacterial endotoxins [lipopolysaccharide (LPS)] results in the activation of an intracellular coagulation cascade (Iwanaga et al., 1986), a defense against microbial invasion Constitutive promoter veg(BBa_K143012) coupled to the strong Ribosome Binding Site spoVG(BBa_K143021) from B. subtilis. These parts have been taken from 2008_Imperial_Collage. Pveg is a constitutive promoter that constitutively expresses the P43 protein in B. subtilis. SpoVG is an endogenous ribosome binding site from B. subtilis. The sequence of the spoVG ribosome binding site is AAAGGUGGUGA which is complementary to the sequence UUUCCUCCACU from the 3' region of the 16s rRNA from B. subtilis. SacB is a signal peptide used in the Sec-SRP (secretory signal recognition particle) pathway by B. subtilis. Signal peptides are responsible for directing preproteins (secretory proteins with a signal peptide region attached) through an appropriate secretory pathway. In the case of the Sec-SRP signal peptide, they direct preproteins from the cytoplasm into the growth medium. Lipopolysaccharide (LPS), or endotoxin, is the major mediator of septic shock, a serious complication of Gram-negative bacterial infections in humans. Molecules that bind LPS and neutralize its biological effects or enhance its clearance could have important clinical applications. Limulus anti-LPS factor (LALF) binds LPS tightly, and, in animal models, reduces mortality when administered before or after LPS challenge or bacterial infection. The wedge- shaped molecule has a striking charge distribution and amphipathicity that suggest how it can insert into membranes. The binding site for LPS probably involves an extended amphipathic loop, and it has been proposed that two mammalian LPS-binding proteins will have a similar loop. The amphipathic loop structure may be used in the design of molecules with therapeutic properties against septic shock. false false _708_ 0 4260 9 Not in stock true During our design, we have looked out that this anti-LPS factor gene should be transfered into gram positive bacteria (i.e. B.subtilis) because of absence of LPS in gram positive bacteria. false Cihan TAŞTAN annotation2123340 1 LALF range2123340 1 226 537 annotation2123337 1 rbs range2123337 1 106 117 annotation2123334 1 BBa_K143053 range2123334 1 1 117 annotation2123335 1 Sigma A-35 range2123335 1 63 68 annotation2123336 1 Sigma A -10 range2123336 1 86 91 annotation2123338 1 BBa_K143021 range2123338 1 106 117 annotation2123339 1 SacB range2123339 1 124 219 annotation2123333 1 BBa_K143012 range2123333 1 1 97 BBa_K541515_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgttactagagaaaggtggtgaatactagatgaacatcaaaaaatttgcaaaacaggcgacagttctgacatttacaacagcactgcttgcaggcggcgcaacacaagcatttgcaaaagaaacatactagatggatggaatttggacacaactgatttttaccctggtgaagaaccttgctacactttggcaatccggcgattttcagttccttgaccatgaatgccattaccgtattaaacctacgtttagacgcttgaagtggaagtataaaggaaaattttggtgcccgtcttggaccagcattactggacgtgcgacaaagtcatcacgctccggtgccgtcgaacattcggtccgaaattttgttgggcaagcgaagtcgtcaggcctgataacgcaaagacaagcggaacagtttattagtcaatacaattaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z