BBa_K541525 1 BBa_K541525 LALF for Bacillus subtilis with LipA signal peptide 2011-07-18T11:00:00Z 2015-05-08T01:12:38Z horseshoe crab and b.subtilis Constitutive promoter veg(BBa_K143012) coupled to the strong Ribosome Binding Site spoVG(BBa_K143021) from B. subtilis. These parts have been taken from 2008_Imperial_Collage. Pveg is a constitutive promoter that constitutively expresses the P43 protein in B. subtilis. SpoVG is an endogenous ribosome binding site from B. subtilis. The sequence of the spoVG ribosome binding site is AAAGGUGGUGA which is complementary to the sequence UUUCCUCCACU from the 3' region of the 16s rRNA from B. subtilis. LipA is a signal peptide from the B. subtilis genome. In general, signal peptides are responsible for directing preproteins (secretory proteins with a signal peptide region attached)through an appropriate secretory pathway[3]. LipA has been successfully used in the secretion of heterologous proteins such as cutinase by B. subtilis. Lipopolysaccharide (LPS), or endotoxin, is the major mediator of septic shock, a serious complication of Gram-negative bacterial infections in humans. Molecules that bind LPS and neutralize its biological effects or enhance its clearance could have important clinical applications. Limulus anti-LPS factor (LALF) binds LPS tightly, and, in animal models, reduces mortality when administered before or after LPS challenge or bacterial infection. The wedge- shaped molecule has a striking charge distribution and amphipathicity that suggest how it can insert into membranes. The binding site for LPS probably involves an extended amphipathic loop, and it has been proposed that two mammalian LPS-binding proteins will have a similar loop. The amphipathic loop structure may be used in the design of molecules with therapeutic properties against septic shock. false false _708_ 0 8463 9 Not in stock false optimized for b.subtilis false Fazilet Guler BBa_K541525_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgttactagagaaaggtggtgaatactagatgaaatttgtgaaaagacgcattattgcactggttacaattctgatgctgtcagttacatcactgtttgcactgcaaccgtcagcaaaagcagcagaacattactagatggatggaatttggacacaactgatttttaccctggtgaagaaccttgctacactttggcaatccggcgattttcagttccttgaccatgaatgccattaccgtattaaacctacgtttagacgcttgaagtggaagtataaaggaaaattttggtgcccgtcttggaccagcattactggacgtgcgacaaagtcatcacgctccggtgccgtcgaacattcggtccgaaattttgttgggcaagcgaagtcgtcaggcctgataacgcaaagacaagcggaacagtttattagtcaatacaattaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z