BBa_K541596 1 BBa_K541596 Reflectin gene with J04500 promoter 2011-09-20T11:00:00Z 2015-05-08T01:12:38Z Horseshoe crab Released HQ 2013 Lipopolysaccharide (LPS), or endotoxin, is the major mediator of septic shock, a serious complication of Gram-negative bacterial infections in humans. Molecules that bind LPS and neutralize its biological effects or enhance its clearance could have important clinical applications. Limulus anti-LPS factor (LALF) binds LPS tightly, and, in animal models, reduces mortality when administered before or after LPS challenge or bacterial infection. The wedge- shaped molecule has a striking charge distribution and amphipathicity that suggest how it can insert into membranes. The binding site for LPS probably involves an extended amphipathic loop, and it has been proposed that two mammalian LPS-binding proteins will have a similar loop. The amphipathic loop structure may be used in the design of molecules with therapeutic properties against septic shock. false false _708_ 0 8463 9 In stock false Optimized for E.coli false Fazilet Guler component2137861 1 BBa_K541506 component2137859 1 BBa_J04500 annotation2137861 1 BBa_K541506 range2137861 1 227 1081 annotation2137859 1 BBa_J04500 range2137859 1 1 220 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961224 1 -35 range1961224 1 137 142 annotation1961227 1 start range1961227 1 173 173 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961222 1 BBa_R0010 range1961222 1 1 200 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J04500 1 BBa_J04500 IPTG inducible promoter with RBS 2005-06-08T11:00:00Z 2015-08-31T04:08:14Z Davidson Synth-Aces Released HQ 2013 R0010.B0034 false true _16_ 0 326 16 In stock false false Kristen DeCelle component1508159 1 BBa_B0034 component1508149 1 BBa_R0010 annotation1508149 1 BBa_R0010 range1508149 1 1 200 annotation1508159 1 BBa_B0034 range1508159 1 209 220 BBa_K541506 1 BBa_K541506 Reflectin1A from Cephalopod 2011-07-18T11:00:00Z 2015-05-08T01:12:38Z Cephalopod Released HQ 2013 Reflectin is a self-assembling protein that has the ability to reflect the sun light which depends on the thickness of the protein layer. Therefore, we thought that this ability could be used as a novel reporter for B.subtilis and E.coli. false false _708_ 0 8463 9 In stock false Optimized for both B.subtilis and E.coli false Fazilet Guler annotation2123461 1 Reflectin range2123461 1 1 855 BBa_K541506_sequence 1 atgaatcgctttatgaatcgctatcgcccgatgttcaataatatgtactctaacatgtaccgtggccgctaccgcggtatgatggaaccgatgagccgcatgactatggactttcagggccgctacatggacagccaaggccgcatggtggacccgcgctactacgattactacggccgcttcaacgattacgaccgctactatggccgcagcatgttcaactatggctggatgatggacggcgatcgctacaaccgctataaccgctggatggattacccggagcgctacatggatatgtctggctaccagatggatatgtctggccgctggatggatatgcagggccgccactgcaacccgtattctcagtggatgatgtacaactacaaccgccatggctactacccgaactactcttacggccgccacatgttttatccggaacgctggatggacatgtctaactactctatggacatgtatggccgctatatggatcgctggggccgctactgtaacccgttttctcagtacatgaactactacggccgctactggaactacccgggctacaataattactactattctcgcaacatgtattacccggaacgctactttgacatgtctaactggcagatggacatgcaaggccgctggatggacaaccagggccgctattgttccccgtactggaacaactggtacggccgccatatgtactacccgtaccagaacaactacttctacggccgctatgactacccgggcatggactattccaactaccaaatggacatgcagggccgctacatggaccagtacggcatgaacgactactactattaataa BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_K541596_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatgaatcgctttatgaatcgctatcgcccgatgttcaataatatgtactctaacatgtaccgtggccgctaccgcggtatgatggaaccgatgagccgcatgactatggactttcagggccgctacatggacagccaaggccgcatggtggacccgcgctactacgattactacggccgcttcaacgattacgaccgctactatggccgcagcatgttcaactatggctggatgatggacggcgatcgctacaaccgctataaccgctggatggattacccggagcgctacatggatatgtctggctaccagatggatatgtctggccgctggatggatatgcagggccgccactgcaacccgtattctcagtggatgatgtacaactacaaccgccatggctactacccgaactactcttacggccgccacatgttttatccggaacgctggatggacatgtctaactactctatggacatgtatggccgctatatggatcgctggggccgctactgtaacccgttttctcagtacatgaactactacggccgctactggaactacccgggctacaataattactactattctcgcaacatgtattacccggaacgctactttgacatgtctaactggcagatggacatgcaaggccgctggatggacaaccagggccgctattgttccccgtactggaacaactggtacggccgccatatgtactacccgtaccagaacaactacttctacggccgctatgactacccgggcatggactattccaactaccaaatggacatgcagggccgctacatggaccagtacggcatgaacgactactactattaataa BBa_B0034_sequence 1 aaagaggagaaa BBa_J04500_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z