BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K249002 1 BBa_K249002 Lumazine Synthase 2009-08-25T11:00:00Z 2015-05-08T01:11:40Z A Science Paper? Lumazine Synthase is an enzyme which creates Lumazine, a product which aggregates forming a hollow spheroid which can act as a mirocompartment, or artificial organelle. The Lumazine forms negatively charged pores, which can be used to introduce proteins. The proteins which are being introduced into the microcompartment must be equipped with an Arginine Tag. false false _242_342_ 0 3171 9 It's complicated true point mutations of EcoRI and PstI sites? false Roxanne Shank BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K542000 1 BBa_K542000 Lumazine Synthase with Transciptional Terminator (No Promoter) 2011-09-21T11:00:00Z 2015-05-08T01:12:38Z [http://partsregistry.org/wiki/index.php?title=Part:BBa_K249002 BBa_K249002] and [http://partsregistry.org/Part:BBa_B0015 BBa_B0015] were obtained from iGEM distribution plates. Composite part: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K249002 BBa_K249002] + [http://partsregistry.org/wiki/index.php/Part:BBa_B0010 BBa_B0010] + [http://partsregistry.org/wiki/index.php/Part:BBa_B0010 BBa_B0010] + [http://partsregistry.org/wiki/index.php/Part:BBa_B0012 BBa_B0012] Made by assembling [http://partsregistry.org/wiki/index.php?title=Part:BBa_K249002 BBa_K249002] with [http://partsregistry.org/Part:BBa_B0015 BBa_B0015] Since this part is lacking the promoter, Lumazine Synthase production may be regulated by the addition different promoters upstream. Regulation of Lumazine Synthase will be dependent on the promoter being utilized. false false _709_ 0 6015 9 It's complicated false Intermediate part to assemble the "Co-localization Construct". false Anthony Vuong component2137873 1 BBa_K249002 component2137880 1 BBa_B0015 annotation2137880 1 BBa_B0015 range2137880 1 474 602 annotation2137873 1 BBa_K249002 range2137873 1 1 465 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K542000_sequence 1 atgcagatttatgaaggcaaactgaccgcggaaggcctgcgctttggcattgtggcgagccgctttaaccatgcgctggtggatcgcctggtggaaggcgcgattgattgcattgtgcgccatggtggtcgcgaagaagatattaccctggtgcgcgtgccgggcagctgggaaattccggtggcggcgggcgaactggcgcgcaaagaagatattgatgcggtgattgcgattggcgtgctgattgaaggcgcggaaccgcattttgattatattgcgagcgaagtgagcaaaggcctggcgaacctgagcctggaactgcgcaaaccgattacctttggcgtgattaccgcggatgaactggaagaagcgattgaacgcgcgggcaccaaacatggcaacaaaggctgggaagcggcgctgagcgcgattgaaatggcgaacctgtttaaaagcctgcgctagtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K249002_sequence 1 atgcagatttatgaaggcaaactgaccgcggaaggcctgcgctttggcattgtggcgagccgctttaaccatgcgctggtggatcgcctggtggaaggcgcgattgattgcattgtgcgccatggtggtcgcgaagaagatattaccctggtgcgcgtgccgggcagctgggaaattccggtggcggcgggcgaactggcgcgcaaagaagatattgatgcggtgattgcgattggcgtgctgattgaaggcgcggaaccgcattttgattatattgcgagcgaagtgagcaaaggcctggcgaacctgagcctggaactgcgcaaaccgattacctttggcgtgattaccgcggatgaactggaagaagcgattgaacgcgcgggcaccaaacatggcaacaaaggctgggaagcggcgctgagcgcgattgaaatggcgaacctgtttaaaagcctgcgctag BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z