BBa_K542010 1 BBa_K542010 Enhanced Lumazine Synthase (ELS) 2011-09-25T11:00:00Z 2015-05-08T01:12:39Z The Enhanced Lumazine Synthase (ELS) sequence was the result of directed evolution. The part was synthesized by Bio Basic Inc. and moved into pSB1C3 by the Lethbridge 2011 team. W??rsd??rfer, B., Woycechowsky, K.J., and Hilvert, D., (2011). Directed Evolution of a Protein Container. ''Science.'' 331: 589-592. Released HQ 2013 The part was synthesized by Bio Basic Inc. into the pET28a plasmid vector with an N-terminal His-tag. The Enhanced Lumazine Synthase (ELS) without the His-tag was moved into the pSB1C3 plasmid vector by the Lethbridge 2011 team. The size of the cavity of the Lumazine Synthase microcompartment was enlarged via directed evolution (W??rsd??rfer ''et al.,'' 2011). The compartment formed by this polypeptide has a larger cavity than the Lumazine Synthase microcompartment submitted by the Lethbridge 2009 team ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K249002 BBa_K249002]). A larger interior allows for the option of localizing larger and/or more proteins into the cavity of the compartment. Reference:<br> W??rsd??rfer, B., Woycechowsky, K.J., and Hilvert, D., (2011). Directed Evolution of a Protein Container. ''Science.'' 331: 589-592. false false _709_ 0 6015 9 In stock true The compartment formed by this polypeptide has a larger cavity than the Lumazine Synthase microcompartment submitted by the Lethbridge 2009 team ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K249002 BBa_K249002]). false Anthony Vuong BBa_K542010_sequence 1 atgcagatctatgaaggtaagctgactgcggaaggtctgcgttttggtattgttgcgtcccgcttcaatcacgcgctggttggccgtctggtagaaggcgcaattgattgcatcgtccgtcacggtggtcgtgaagaagacattacgctggtgtgtgtgccaggttcttgggagatccctgtagcggctggcgaactggctcgtaaagaggatatcgacgctgttatcgcaatcggtgttctgatcgaaggcgctgaaccgcacttcgattacattgccagcgaagtgtctaaaggcctggctaacctgtccctggaactgcgcaaaccgatcagcttcggtgacattaccgatgacgaactggaggaggccatcgagtgcgccggtaccgaacatggcaacaaaggctgggaagcggcgctgtctgcaatcgaaatggcaaacctgttcaaatccctgcgctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z