BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K543002 1 BBa_K543002 HNS mutant T108I 2011-10-02T11:00:00Z 2015-05-08T01:12:39Z E.coli T108I mutant HNS protein false false _710_ 0 5967 9 It's complicated true protein coding false Kazuki Watanabe annotation2150849 1 mutation T108I range2150849 1 323 323 annotation2150848 1 HNS protein range2150848 1 1 414 BBa_K543003 1 BBa_K543003 HNS mutant T108I protein generator 2011-10-03T11:00:00Z 2015-05-08T01:12:39Z BBa_J23101 BBa_B0010 BBa_K543002 BBa_B0010 BBa_B0012 HNS mutant T108I protein generator false false _710_ 0 5967 9 Not in stock false promoter rbs protein terminator false Kazuki Watanabe component2152470 1 BBa_B0012 component2152463 1 BBa_B0030 component2152461 1 BBa_J23101 component2152467 1 BBa_K543002 component2152468 1 BBa_B0010 annotation2152468 1 BBa_B0010 range2152468 1 487 566 annotation2152467 1 BBa_K543002 range2152467 1 65 478 annotation2152463 1 BBa_B0030 range2152463 1 44 58 annotation2152470 1 BBa_B0012 range2152470 1 575 615 annotation2152461 1 BBa_J23101 range2152461 1 1 35 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation7025 1 BBa_B0030 range7025 1 1 15 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0030_sequence 1 attaaagaggagaaa BBa_K543002_sequence 1 atgagcgaagcacttaaaattctgaacaacatccgtactcttcgtgcgcaggcaagagaatgtacacttgaaacgctggaagaaatgctggaaaaattagaagttgttgttaacgaacgtcgcgaagaagaaagcgcggctgctgctgaagttgaagagcgcactcgtaaactgcagcaatatcgcgaaatgctgatcgctgacggtattgacccgaacgaactgctgaatagccttgctgccgttaaatctggcaccaaagctaaacgtgctcagcgtccggcaaaatatagctacgttgacgaaaacggcgaaactaaaatctggactggccaaggccgtactccagctgtaatcaaaaaagcaatggatgagcaaggtaaatccctcgacgatttcctgatcaagcaataa BBa_K543003_sequence 1 tttacagctagctcagtcctaggtattatgctagctactagagattaaagaggagaaatactagatgagcgaagcacttaaaattctgaacaacatccgtactcttcgtgcgcaggcaagagaatgtacacttgaaacgctggaagaaatgctggaaaaattagaagttgttgttaacgaacgtcgcgaagaagaaagcgcggctgctgctgaagttgaagagcgcactcgtaaactgcagcaatatcgcgaaatgctgatcgctgacggtattgacccgaacgaactgctgaatagccttgctgccgttaaatctggcaccaaagctaaacgtgctcagcgtccggcaaaatatagctacgttgacgaaaacggcgaaactaaaatctggactggccaaggccgtactccagctgtaatcaaaaaagcaatggatgagcaaggtaaatccctcgacgatttcctgatcaagcaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z