BBa_K545666 1 BBa_K545666 rpos leader sequence 2011-09-20T11:00:00Z 2015-05-08T01:12:39Z This bricks comes from escherichia coli Released HQ 2013 This leader sequence originally from the 5'-untranslated RNA of the rpoS gene. Its particular secondary structure places the ribosome binding site into a double-stranded region and therefore prevents recognition by the ribosome. A small RNA, called dsrA can interacts with it and induces a change that liberates the RBS and thus stimulates the translation the downstream gene. false false _712_ 0 8648 9 In stock false It has been extracted from colony by PCR and cloned into PSB1C3. false Grenoble 2011 annotation2137872 1 rpos range2137872 1 1 223 BBa_K545666_sequence 1 cccataacgacacaatgctggtccgggaacaacaagaagttaaggcggggcaaaaaatagcgaccatgggtagcaccggaaccagttcaacacgcttgcattttgaaattcgttacaaggggaaatccgtaaacccgctgcgttatttgccgcagcgataaatcggcggaaccaggcttttgcttgaatgttccgtcaagggatcacgggtaggagccacctt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z