BBa_K549002 1 BBa_K549002 Nickel(II) dependent promotor with lacZ' as reporter 2011-09-11T11:00:00Z 2015-05-08T01:12:39Z The RcnA promotor is amplified from E. coli K12 The lacZ' reporter gene is abstracted from the BB_J33202. The biobrick contains the RcnA promotor from E. coli fused with the lacZ' reporter gene. E coli strains own the RcnR-regulator gene which direct regulates the transcription of the RcnA nickel cobalt efflux protein from which the promotor is amplified. In presence of nickel the LacZ' is expressed. false false _717_ 0 6347 9 It's complicated false There where no special considerations we had to deal with. false Sabine Wagner component2137452 1 BBa_K549038 component2137455 1 BBa_J33202 annotation2137452 1 BBa_K549038 range2137452 1 1 213 annotation2137455 1 BBa_J33202 range2137455 1 222 464 BBa_K549038 1 BBa_K549038 Promotor prcnA of rcnA with RcnR-binding site and 50nt rcnA 2011-09-20T11:00:00Z 2015-05-08T01:12:40Z It originates from E.coli K12 MG 1655 gDNA. This is the promoter of rcnA, called prcnA. It has a binding site for the regulator RcnR, which originates in E. coli. In presence of Ni(II), Ni(II) binds to RcnR, RcnR binds to the promoter and activates transcription. Co(II) can also be a stimulus, but a weaker one. This promoter contains the first ca. 50 nt of rcnA, and therefore is used for transcriptional fusion with genes with RBS. false false _717_ 0 6378 9 Not in stock false This promoter contains the first ca. 50 nt of rcnA, and therefore is used for transcriptional fusion with genes with RBS. This BB can be used for measurement of Ni(II)-concentration. false Jara Radeck BBa_J33202 1 BBa_J33202 lacZ 2006-10-12T11:00:00Z 2015-08-31T04:08:46Z The DNA was derived by PCR from E. coli BL21, which possesses an intact lacZ gene. Primers were designed based on sequence from GenBank accession J01636, GI:146575. A stop codon was artificially introduced to replace codon 78. The sequence reported here is derived by sequencing of the Biobrick construct. Released HQ 2013 This gene encodes the N-terminal 77 amino acid residues of LacZ. When expressed in an E. coli host carrying the lacZ-delta-M15 mutation, common in laboratory strains, it complements the delection resulting in the production of active LacZ, which can be detected by various means, including chromogenic substrates such as Xgal (5-bromo-4-chloro-3-indolyl-beta-D-galactoside) and ONPG (o-nitrophenyl galactoside). false false _63_ 0 837 63 In stock true Note that a stop codon was introduced to replace codon 78 of lacZ, resulting in production only of the N-terminal 77 amino acid residues of LacZ. This is sufficient to complement the lacZ-delta-M15 mutation commonly found in laboratory strains of E. col used for alpha-complementation. false Chris French annotation1902819 1 lacZ' range1902819 1 13 243 annotation1902818 1 rbs range1902818 1 1 4 BBa_J33202_sequence 1 gaggaaacagctatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtga BBa_K549038_sequence 1 acggattgtatgagacatggcaacacctggttaacaagaatatgaaaaatcatagcactattaatctactggggggtagtatcaggtactgggggggagtagaatcagattgccgaattaatactaagaattattatcatgaccgaatttacaactcttcttcagcaaggaaacgcctggttcttcatccccagcgccatcttacttggtgcg BBa_K549002_sequence 1 acggattgtatgagacatggcaacacctggttaacaagaatatgaaaaatcatagcactattaatctactggggggtagtatcaggtactgggggggagtagaatcagattgccgaattaatactaagaattattatcatgaccgaatttacaactcttcttcagcaaggaaacgcctggttcttcatccccagcgccatcttacttggtgcgtactagaggaggaaacagctatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z