BBa_K549007 1 BBa_K549007 PnorB + RBS + lacZ-reporter gene 2011-09-15T11:00:00Z 2015-05-08T01:12:39Z Neisseria meningitidis The promoter PnorB is regulated by the repressor NorB. In presence of iron (2+) ions the transcription of the reporter gene is activated. In this the case, the reporter is lacZ' (BBa_J33202). false false _717_ 0 6909 9 It's complicated false - false Tobias Bauer annotation2129454 1 PnorB range2129454 1 1 123 annotation2129458 1 lacZ' range2129458 1 124 366 BBa_K549007_sequence 1 catggcaacacctggttaacaagaatatgaaaaatcatagcactattaatctactggggggtagtatcaggtactgggggggagtagaatcagattgccgaattaatactaagaattattatcgaggaaacagctatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z