BBa_K553002 1 BBa_K553002 PTraI - TraR-OC8 HLA complex regulated promoter 2011-09-16T11:00:00Z 2015-05-08T01:12:40Z http://www.ncbi.nlm.nih.gov/nucleotide/8572673?report=genbank&log$=nuclalign&blast_rank=1&RID=795BNUZN014 PTraI promoter was obtained by PCR from Agrobacterium Tumefaciens gDNA. This part is positively regulated in presence of the TraR trans-activator and oc8 HLA. false false _721_ 0 8730 9 It's complicated false the pcr amplification worked well, few mutation observed after sequencing that are present in our strain false Giulio Bernardinelli BBa_K553002_sequence 1 aagtaacgcgaagtgcagatttgcacatgaaatcaacgctgcacgagatcgattgcacgcgcaaatcgctttttgaagactgactcagtagaatcactacgtgcagatctgcacatagccacaccctgaatgagatgttttctctccgcta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z