BBa_R0079 1 LasR+PAI Promoter (LasR & PAI regulated) 2004-01-27T12:00:00Z 2015-05-08T01:14:15Z "Analysis of the Pseudomonas aeruginosa Elastase (lasB) Regulatory Region". Lynn Rust, Everett Pesci, and Barbara Iglewski Released HQ 2013 Binding region for LasR protein (positive regulation) false true _1_ 0 24 7 In stock false true Alvin Carter Powers (Fighting Darwins) annotation318496 1 -10 range318496 1 140 145 annotation300992 1 OP1 range300992 1 106 125 annotation300985 1 OP2 range300985 1 46 63 annotation318495 1 -35 range318495 1 117 122 BBa_K553008 1 BBa_K553008 OC8 HLA synthase induced by OC12 HLA 2011-09-16T11:00:00Z 2015-05-08T01:12:40Z nol jubbju false false _721_ 0 8730 9 It's complicated true nono false Giulio Bernardinelli, Veronica Parisi, Francesca Cesaratto component2130234 1 BBa_R0079 component2130245 1 BBa_B0015 component2130236 1 BBa_B0034 component2130238 1 BBa_K553001 annotation2130234 1 BBa_R0079 range2130234 1 1 157 annotation2130238 1 BBa_K553001 range2130238 1 184 822 annotation2130236 1 BBa_B0034 range2130236 1 166 177 annotation2130245 1 BBa_B0015 range2130245 1 831 959 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K553001 1 BBa_K553001 A. tumefaciens TraI - OC8 HLA synthase 2011-09-16T11:00:00Z 2015-05-08T01:12:40Z http://www.ncbi.nlm.nih.gov/nucleotide/81176483?report=genbank&log$=nuclalign&blast_rank=1&RID=79664K7A015 This part was obtained by PCR from Agrobacterium Tumefaciens gDNA. This trans-activator binds oc8 HLA and then positively regulates PTraI promoter false false _721_ 0 8730 9 It's complicated false this coding sequence become a standard Biobrick via per without any particular problems false Giulio Bernardinelli annotation2130091 1 start range2130091 1 1 3 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_K553008_sequence 1 gcccctcgctgagcgcgtcccggagctgggggcaacctagctgccacctgcttttctgctagctattccagcgaaaacatacagatttccggcgaaatcaaggctacctgccagttctggcaggtttggccgcgggttctttttggtacacgaaagctactagagaaagaggagaaatactagatgctgattctgaccgtctcgcccgaccaataccaacaccagaacagttacctcaagcaaatgcaccggcttcgagccgaagtgtttggaaaccgtctgaaatgggatgtcgcaatagaggacggcggcgaacgggatcaatacgacgagctcagcccgacctacattctcgcgacgttcggtgggcagagggtggtcggctgcgcacggcttcttgcgccatcaggaccgaccatgctggagcggacgtttccgcaattgctggcaaccggctccctcagcgcaaccacggcaatgatcgaaacgtcacgcttctgcgtcgacacgacattgccgaccgggagggcagggaggcaactgcatctcgcgacgctcaccatgttcgccggcatcatcgaatggtcgatggcaaacggctacgacgaaattgtcacggcaaccgatcttcgcttcgaacgcatcttgaagcgcgccggttggccgatgacgcgactgggcgaacccgtcgcgattggcaacaccgtcgccgtcgccggacatttgcccgccgaccgaaaaagcttcgaacgggtctgcccgccgggataccgttcgattatcgctgacgataacggccgcccgttgaggagtgcggcgtgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K553001_sequence 1 atgctgattctgaccgtctcgcccgaccaataccaacaccagaacagttacctcaagcaaatgcaccggcttcgagccgaagtgtttggaaaccgtctgaaatgggatgtcgcaatagaggacggcggcgaacgggatcaatacgacgagctcagcccgacctacattctcgcgacgttcggtgggcagagggtggtcggctgcgcacggcttcttgcgccatcaggaccgaccatgctggagcggacgtttccgcaattgctggcaaccggctccctcagcgcaaccacggcaatgatcgaaacgtcacgcttctgcgtcgacacgacattgccgaccgggagggcagggaggcaactgcatctcgcgacgctcaccatgttcgccggcatcatcgaatggtcgatggcaaacggctacgacgaaattgtcacggcaaccgatcttcgcttcgaacgcatcttgaagcgcgccggttggccgatgacgcgactgggcgaacccgtcgcgattggcaacaccgtcgccgtcgccggacatttgcccgccgaccgaaaaagcttcgaacgggtctgcccgccgggataccgttcgattatcgctgacgataacggccgcccgttgaggagtgcggcgtga BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0079_sequence 1 gcccctcgctgagcgcgtcccggagctgggggcaacctagctgccacctgcttttctgctagctattccagcgaaaacatacagatttccggcgaaatcaaggctacctgccagttctggcaggtttggccgcgggttctttttggtacacgaaagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z