BBa_K553022 1 BBa_K553022 Eukaryotic minimal CMV promoter 2011-09-16T11:00:00Z 2015-05-08T01:12:40Z a This part is a minimal CMV promoter (CMVmin) and can be associated to any kind of inducer/reporter in order to obtain a inducible eukaryotic gene expression system. false false _721_ 0 8729 9 It's complicated false a false Luca Braga, Niels Ntamati BBa_K553022_sequence 1 gtgtgcagatctgcacatcggcaacgcgtcgccgggtcgaggtaggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccgcggcct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z