BBa_K554000 1 BBa_K554000 SoxS promoter 2011-09-20T11:00:00Z 2015-05-08T01:12:40Z Synthesized sequence. Released HQ 2013 SoxS promoter false false _722_ 0 7971 9 In stock true false UNICAMP_EMSE Brazil team annotation2136873 1 SoxS range2136873 1 1 62 BBa_K554000_sequence 1 aatcgctttacctcaagttaacttgaggaattatactccccaacagatgaattaacgaactg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z