BBa_B0014 1 BBa_B0014 double terminator (B0012-B0011) 2003-07-15T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0012 and BBa_B0011 false true _1_ 0 24 7 In stock false true Reshma Shetty component939303 1 BBa_B0012 component939311 1 BBa_B0011 annotation939311 1 BBa_B0011 range939311 1 50 95 annotation939303 1 BBa_B0012 range939303 1 1 41 BBa_K554010 1 BBa_K554010 SoxR device 2011-09-25T11:00:00Z 2015-05-08T01:12:40Z Synthesized sequence and Registry entries. SoxR device is ... false false _722_ 0 7971 9 It's complicated true false UNICAMP EMSE Brazil team component2141658 1 BBa_B0014 component2141647 1 BBa_J23119 component2141651 1 BBa_K554003 annotation2141647 1 BBa_J23119 range2141647 1 1 35 annotation2141658 1 BBa_B0014 range2141658 1 535 629 annotation2141651 1 BBa_K554003 range2141651 1 44 526 BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation1683 1 stem_loop range1683 1 13 35 annotation7019 1 BBa_B0011 range7019 1 1 46 BBa_J23119 1 BBa_J23119 constitutive promoter family member 2006-08-23T11:00:00Z 2015-08-31T04:08:40Z Overlap extension of synthetic oligonucleotides Released HQ 2013 Later false true _52_ 0 483 95 In stock false N/A true John Anderson BBa_K554003 1 BBa_K554003 SoxR 2011-09-20T11:00:00Z 2015-05-08T01:12:40Z Synthesized sequence. Released HQ 2013 SoxR is ... false false _722_ 0 7971 9 In stock true false UNICAMP EMSE Brazil team annotation2136855 1 RBS range2136855 1 1 15 annotation2136870 1 SoxR range2136870 1 16 477 annotation2136872 1 stop range2136872 1 478 483 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_K554010_sequence 1 ttgacagctagctcagtcctaggtataatgctagctactagagattaaagaggagaaaatggaaaagaaattaccccgcattaaagcgctgctaacccccggcgaagtggcgaaacgcagcggtgtggcggtatcggcgctgcatttctatgaaagtaaagggttgattaccagtatccgtaacagcggcaatcagcggcgatataaacgtgatgtgttgcgatatgttgcaattatcaaaattgctcagcgtattggcattccgctggcgaccattggtgaagcgtttggcgtgttgcccgaagggcatacgttaagtgcgaaagagtggaaacagctttcgtcccaatggcgagaagagttggatcggcgcattcataccttagtggcgctgcgtgacgaactggacggatgtattggttgtggctgcctttcgcgcagtgattgcccgttgcgtaacccgggcgaccgcttaggagaagaaggtaccggcgcacgcttgctggaagatgaacaaaactaataatactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_B0014_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_K554003_sequence 1 attaaagaggagaaaatggaaaagaaattaccccgcattaaagcgctgctaacccccggcgaagtggcgaaacgcagcggtgtggcggtatcggcgctgcatttctatgaaagtaaagggttgattaccagtatccgtaacagcggcaatcagcggcgatataaacgtgatgtgttgcgatatgttgcaattatcaaaattgctcagcgtattggcattccgctggcgaccattggtgaagcgtttggcgtgttgcccgaagggcatacgttaagtgcgaaagagtggaaacagctttcgtcccaatggcgagaagagttggatcggcgcattcataccttagtggcgctgcgtgacgaactggacggatgtattggttgtggctgcctttcgcgcagtgattgcccgttgcgtaacccgggcgaccgcttaggagaagaaggtaccggcgcacgcttgctggaagatgaacaaaactaataa BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23119_sequence 1 ttgacagctagctcagtcctaggtataatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z