BBa_K562000 1 Tatprom Eco_Ptat 2011-09-15T11:00:00Z 2015-05-08T01:12:41Z This is from the Escherichia coli K-12 MG1655 genomic sequence. Released HQ 2013 The constitutive promoter region (97 bp) from the Escherichia coli K-12 tatABCD (twin-arginine translocase) operon. This is a constitutive promoter that gives good levels of expression in E. coli, but is not inducible or repressible. The promoter region is cloned as an EcoRI / PstI fragment into pSB1C3 and is also known as "pSB-Ptat" in the Sargent Laboratory at Dundee, UK. The cloned fragment includes the tatA RBS. false true _730_ 0 8083 9 In stock false The clone carries a BamHI restriction site at its 3' end (increasing the length of the part to 103 bp). If you use this site for cloning, and place a BamHI site (or similar 6-nucleotide site with compatible ends) immediately upsteam of the ATG start codon of your gene of interest, then this places your ATG in exactly the correct position to be initiated from the tatA RBS within the promoter region. false Frank Sargent annotation2129390 1 tatA RBS range2129390 1 92 97 BBa_K562000_sequence 1 tgtcggttggcgcaaaacacgctgattttttcatcgctcaaggcgggccgtgtaacgtataatgcggctttgtttaatcatcatctaccacagaggaggatcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z