BBa_K562001 1 Salty_D20 Salty_PduD20 Targeting Tag 2011-09-15T11:00:00Z 2015-05-08T01:12:41Z Derived from Salmonella enterica serovar Typhimurium LT2 genomic sequence. This is a composite part comprising a constituive promoter (identical to that from the basic part BBa_K562000), which is the tatABCD promoter from E. coli K-12, driving production of the first 20 amino acid residues of the PduD protein from Salmonella enterica serovar Typhimurium LT2. This is a targeting sequence for the Salmonella Pdu bacterial microcompartment (BMC). This 20 residue targeting sequence has been tested by fusion to GFP and it does work. The construct is coloned as an EcoRI / PstI fragment into pSB1C3. The clone is also known as pSB-D20 in the Sargent Laboratory, Dundee, UK. false false _730_ 0 8083 9 It's complicated false The fragment carries an XbaI site at the extreme 3' end. Thus, to clone your gene of interest in-frame with this targeting sequence all you need do is place the 6-nucleotide XbaI site immediately upstream of your ATG initiation codon. false Frank Sargent annotation2129400 1 BBa_K562000 range2129400 1 1 103 annotation2129402 1 PduD20 Tag range2129402 1 119 178 annotation2129401 1 synthetic RBS range2129401 1 107 112 BBa_K562001_sequence 1 tgtcggttggcgcaaaacacgctgattttttcatcgctcaaggcgggccgtgtaacgtataatgcggctttgtttaatcatcatctaccacagaggaggatcacacagaggaacaggtatggaaattaatgaaaaattgctgcgccagataattgaagacgtactccgcgatatgaagtctaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z