BBa_K562004 1 Salty_PduJ Salty_PduJK BMC Components 2011-09-15T11:00:00Z 2015-05-08T01:12:41Z Derived from Salmonella enterica serovar Typhimurium LT2 genomic sequence. This is a composite part comprising a constituive promoter (identical to that from the basic part BBa_K562000), which is the tatABCD promoter from E. coli K-12, driving production of the PduJ and PduK proteins from Salmonella enterica serovar Typhimurium LT2. These are components of the Salmonella bacterial microcompartment (BMC). The PduK gene product carries a C-terminal 6-His affinity/epitope tag. Production of the PduK protein has been verified by Western immunoblotting (anti-penta-His) and production of both PduJ and PduK have been confirmed by 35S-Met labelling. The proteins have also been purified from E. coli by immobilised metal affinity chromatography (IMAC) and identified by tryptic peptide mass fingerprinting. The construct is cloned as an EcoRI / PstI fragment into pSB1C3. The clone is also known as pSB-JK in the Sargent Laboratory, Dundee, UK. false false _730_ 0 8083 9 In stock false The fragment carries an engineered BamHI site at its extreme 3' end, but note that this is because a generic primer design system was used. Be aware that the pduK gene carries 2 native BamHI sites. false Frank Sargent annotation2129422 1 Hexa-Histidine Tag range2129422 1 878 895 annotation2129418 1 BBa_K562000 range2129418 1 1 103 annotation2129420 1 pduJ gene range2129420 1 119 394 annotation2129419 1 synthetic range2129419 1 107 112 annotation2129421 1 pduK gene range2129421 1 419 877 BBa_K562004_sequence 1 tgtcggttggcgcaaaacacgctgattttttcatcgctcaaggcgggccgtgtaacgtataatgcggctttgtttaatcatcatctaccacagaggaggatcacacagaggaacaggtatgaataacgcactgggactggttgaaacaaaagggctggtcggcgccattgaagccgccgatgcaatggttaaatccgccaacgtacagctggtgggctacgaaaaaattggttctggcctggtgaccgtcatggttcgcggcgatgtcggcgcggttaaagcagccgtagatgccggcagcgcagcggcaagcgtcgtgggtgaagtgaaatcctgccacgttatcccgcgtccgcacagcgatgttgaggccattttaccgaaatcagcctaatcgatggcgaataaggagcaccgcgtgaagcaatcactgggattacttgaagtttgtggtctggcactggctatcagctgcgccgatatcatggcgaaatccgcttctatcacgctgctcgccctcgaaaagaccaatggttcaggctggatggtgattaaaattaccggtgatgtggcctccgttcaggcggctatcaccaccggtgcgcatttcgccgaacagtggaatggcctggtggcccacaaggttatcgccaggcccggagaagggatcctgctcgcagagacaccctccccctccgtcattgaacctgagcctgaagcgtcagagatagctgatgtcgtttctgaagcgccagccgaagaggccccgcaggaatcagaactggtcagctgcaatctgtgtctggatccaaaatgtccgcgccagaagggcgaacctcgtacgctttgcattcattccggcaagcgaggtgaagcgcatcaccatcaccatcactaaggatcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z